CD8+ T cells are key mediators of antiviral and antitumor immunity. The isolation and study of Ag-specific CD8+ T cells, as well as mapping of their MHC restriction, has practical importance to the study of disease and the development of therapeutics. Unfortunately, most experimental approaches are cumbersome, owing to the highly variable and donor-specific nature of MHC-bound peptide/TCR interactions. Here we present a novel system for rapid identification and characterization of Ag-specific CD8+ T cells, particularly well suited for samples with limited primary cells. Cells are stimulated ex vivo with Ag of interest, followed by live cell sorting based on surface-trapped TNF-α. We take advantage of major advances in single-cell sequencing to generate full-length sequence data from the paired TCR α- and β-chains from these Ag-specific cells. The paired TCR chains are cloned into retroviral vectors and used to transduce donor CD8+ T cells. These TCR transductants provide a virtually unlimited experimental reagent, which can be used for further characterization, such as minimal epitope mapping or identification of MHC restriction, without depleting primary cells. We validated this system using CMV-specific CD8+ T cells from rhesus macaques, characterizing an immunodominant Mamu-A1*002:01-restricted epitope. We further demonstrated the utility of this system by mapping a novel HLA-A*68:02-restricted HIV Gag epitope from an HIV-infected donor. Collectively, these data validate a new strategy to rapidly identify novel Ags and characterize Ag-specific CD8+ T cells, with applications ranging from the study of infectious disease to immunotherapeutics and precision medicine.

CD8+ T cells are key mediators of antiviral and antitumor immunity (1, 2). During maturation, naive T cells undergo somatic DNA rearrangement to form a unique TCR (3, 4). This receptor is a heterodimer of two unique and variable TCR chains (most commonly α- and β-chains), which interact with the invariant CD3 chains (5). The α/β-chains form a receptor that recognizes antigenic peptides presented by MHC molecules on the APC. The diversity of MHC/HLA genotypes across the population ensures that the identity of antigenic peptides is equally diverse and donor specific. Determining the identity of these antigenic peptide/MHC pairs can be a laborious and expensive process (6, 7). For these reasons, the study of CD8+ T cells frequently leverages a handful of well-characterized immunodominant epitopes presented by common MHC/HLA alleles, such as Mamu-A1*001:01 (A*01)/SIV Tat SL8 in SIV-infected macaques, HLA*B27/HIV Gag KK10 in HIV-infected humans, or HLA-A*0201/IAV M158–66 in influenza-infected humans (811).

Characterizing the CD8+ T cell response to a pathogen does not necessarily require knowing the identity of the antigenic peptides. Upon antigenic stimulation, such as APCs pulsed with peptide pools or virally infected targets, activated CD8+ T cells can upregulate surface markers or secrete cytokines, including IFN-γ and TNF-α. Flow cytometric or ELISPOT assays take advantage of these markers to identify and perform basic characterization of responding cells (12, 13). One common flow-based assay is intracellular cytokine staining (ICS), in which CD8+ T cells are exposed to Ags in the presence of brefeldin A, a compound that inhibits protein transport from the endoplasmic reticulum (14). Brefeldin A prevents cytokine secretion, trapping IFN-γ and TNF-α within the cell, thereby providing a highly sensitive flow-based readout of activation (14, 15). It should be noted that ICS requires fixation and permeabilization of the cells, and therefore does not permit isolation of viable cells. If viable cells are required, staining and sorting using fluorescently labeled MHC class I tetramers (or higher-order multimers), remains the gold standard (16, 17). Although these tetramers can be highly specific, they are limited to previously characterized MHC/peptide specificities, making them costly to generate and limiting the utility of a given tetramer. Cytokine capture methods provide an alternative to tetramer staining (18). One form of capture assays uses bispecific Abs to tether a secreted molecule, such as IFN-γ, to the cell surface (1921). Capture methods have the advantage of not requiring knowledge of antigenic peptides, and they can provide viable cells for downstream characterization; however, they often require species-specific reagents. An alternative cytokine capture method involves incubating CD8+ T cells in the presence of TAPI-0, a metalloprotease inhibitor that blocks the activity of TNF-α converting enzyme (TACE) (22). TACE inhibition prevents the cleavage of TNF-α, thereby tethering it to the cell surface and providing a surface marker that can be used to live sort viable cells. TCR sequencing has demonstrated that CD8+ T cells sorted using surface-trapped TNF-α can be highly specific and sensitive (23). Sorting cells based on functional attributes, such as TNF-α production, may even have advantages over tetramer staining because it identifies cells that are functional, and may identify clones with TCRs that bind with low affinity to MHC molecules (24, 25). For these reasons, although TCR sequencing has demonstrated that the set of clones identified by cytokine capture assays broadly recapitulate tetramer staining, the clonal frequencies are not expected to be identical for each method (23, 24).

Identification of Ag-specific TCR sequences would provide an alternative strategy to study CD8+ T cells; however, the identification of TCR sequences can be extremely laborious. A productive α/β TCR is composed of two independently coded chains (26, 27). Generating the sequence of the paired α/β TCRs from Ag-specific CD8+ T cells is most readily accomplished through single-cell sequencing (28). Single-cell sequencing methods have advanced dramatically, with droplet based methods now capable of capturing transcriptomic data from thousands of individual cells in a single experiment (2931). Further, these methods have been extended to allow PCR enrichment of TCR or BCR sequences, providing near full-length sequence data (32). Once the sequence is known, the TCR α/β pair can be synthesized and exogenously expressed in donor CD8+ T cells (33, 34). This exogenous expression has been shown to recapitulate the antigenic potential of the original cell (35, 36). Further, modifications have been published to enhance the surface expression of exogenous TCR, and prevent pairing with any endogenous TCR from the donor cells (37).

We reasoned that the combination of cytokine capture, massively parallel single-cell sequencing, and exogenous TCR expression in donor cells would provide a novel system to characterize Ag-specific CD8+ T cells and identify antigenic peptides. This scheme is especially well suited to situations where primary cells are limited, because it only requires one round of screening and TCR identification from primary patient samples. We tested this system using CMV-specific CD8+ T cell responses in rhesus macaques, validating the sensitivity and accuracy of this approach. We further demonstrate efficacy using cells from an HIV-infected donor, successfully mapping a novel HLA-A*68:02-restricted HIV Gag epitope.

A total of 24 Indian-origin rhesus macaques were used in this study. At assignment, all study macaques were free of cercopithecine herpesvirus 1, d-type simian retrovirus, simian T-lymphotropic virus type 1, and Mycobacterium tuberculosis. All animals, except for the enhanced-specific pathogen-free macaques, were naturally infected with rhesus CMV (RhCMV). All study macaques were housed at the Oregon National Primate Research Center (ONPRC) in animal biosafety level 2 rooms with autonomously controlled temperature, humidity, and lighting. Macaques were fed commercially prepared primate chow twice daily and received supplemental fresh fruit or vegetables daily. Fresh, potable water was provided via automatic water systems. Physical examinations including body weight and complete blood counts were performed at all protocol time points. Macaque care and all experimental protocols and procedures were approved by the ONPRC Institutional Animal Care and Use Committee. The ONPRC is a category I facility. The Laboratory Animal Care and Use Program at the ONPRC is fully accredited by the American Association for Accreditation of Laboratory Animal Care and has an approved assurance (Number A3304-01) for the care and use of animals on file with the National Institutes of Health Office for Protection from Research Risks. The Institutional Animal Care and Use Committee adheres to national guidelines established in the Animal Welfare Act (7 U.S. Code, sections 2131–2159) and the Guide for the Care and Use of Laboratory Animals, Eighth Edition as mandated by the U.S. Public Health Service Policy.

This study includes PBMC samples from a patient enrolled in the well-characterized Study of the Consequences of the Protease Inhibitor Era (SCOPE) cohort. SCOPE is an observational prospective cohort based on the HIV/AIDS clinics at the Zuckerberg San Francisco General Hospital and the San Francisco Veterans Affairs Medical Center (San Francisco, CA). All subjects provided written informed consent and the parent study was approved by the University of California, San Francisco Committee on Human Research. All subjects were characterized with respect to age, gender, ethnicity, HIV status (serostatus, blood CD4+ and CD8+ T cell counts, plasma HIV RNA concentrations), and antiretroviral therapy regimen.

PBMCs from RhCMV-infected Mamu-A1*002:01 (Mamu-A*02) rhesus macaques were isolated from anticoagulant-treated whole blood by Ficoll density gradient centrifugation (GE Healthcare). Tetramers for the Mamu-A*02-restricted RhCMV IE-2313–322 AN10 were provided by the National Institutes of Health Tetramer Core Facility. For tetramer staining, ∼1–2 × 106 cells were placed in 100 μl of RPMI 1640 (with 10% FBS). Tetramer was added at a final concentration of 100 nM and cells were incubated in the dark at 37°C for 30 min. Subsequently, cells were stained for anti-CD3 (clone: SP34-2, Pacific Blue; BD Biosciences), anti-CD8 (clone: SK1, TruRed; BD Biosciences), anti-CD4 (clone: L200, PE-Cy7; BD Biosciences), anti-CD14 (clone M5E2, FITC; BioLegend), anti-CD16 (clone 3G8, FITC; BioLegend), and LIVE/DEAD Fixable Near Infra-Red Dead Cell Stain (Life Technologies) and were incubated for an additional 30 min in the dark at 4°C. Cells were then washed once with 1× PBS and fixed with 2% paraformaldehyde. Sample collection was performed on LSR-II or FACSymphony instruments (BD Biosciences), and analysis was conducted with FlowJo software (Tree Star).

All peptides used in these studies were synthesized by Genscript. RhCMV (Genbank accession MT157325: https://www.ncbi.nlm.nih.gov/nuccore/MT157325) peptide pools consisted of 15mer peptides overlapping by 11 aa corresponding to the nonoverlapping exons of RhCMV IE-1 and RhCMV IE-2 (38). Peptide pools from HIV-1 Clade B Gag were provided by the National Institutes of Health AIDS Research and Reference Reagent Program (Germantown, MD). PBMCs were isolated from anticoagulant-treated whole blood by Ficoll density gradient centrifugation (GE Healthcare). B-lymphoblastoid cell lines (BLCLs) were generated by infecting macaque and human PBMCs with herpesvirus papio or EBV, respectively, as previously described (3941). APCs were pulsed with peptides of interest at a final concentration of 10 μM for 90 min then washed three times with warm PBS and once with warm R10 (RPMI 1640 supplemented with 10% FBS, l-glutamine, and antibiotic/antimycotic) to remove unbound peptide before combining with effectors. The 0.221 cell lines expressing single HLA alleles were generated using lentiviral transduction as described previously (42). HLA fragments were cloned into the modified pLVX-EF1α-IRES-Puro (Clontech) vector, in which EF1α was replaced with the spleen focus-forming virus promoter. The expression cassette encoded ZsGreen linked via self-cleaved P2A peptide to HLA with a FLAG-tag at its N terminus. HLA-positive cells were selected using 0.25 μg/ml puromycin.

APCs were pulsed with peptides of interest at a final concentration of 10 μM for 90 min, washed three times with warm PBS, and once with warm R10 (RPMI 1640 supplemented with 10% FBS, l-glutamine, and antibiotic/antimycotic) to remove unbound peptide before combining with effectors.

CD8+ T cell responses were measured by flow cytometric ICS. PBMCs, isolated CD8β+ T cells, or CD8+ T cell transductants were incubated with peptide-pulsed BLCLs as described above or free peptide at a final concentration of 10 μM, and the costimulatory molecules CD28 and CD49d (BD Biosciences) for 1 h, followed by addition of brefeldin A (Sigma-Aldrich) for an additional 8 h. Costimulation with unpulsed APCs served as background controls. Stimulated cells were stained, collected, and analyzed as previously described (43, 44). Briefly, cells were washed with 1× PBS, surface stained for 30 min, washed with PBS, fixed with 2% paraformaldehyde, permeabilized with Medium B buffer (ThermoFisher), and stained intracellularly for 1 h. Abs used for ICS were anti-CD3 (clone: SP34-2, Pacific Blue; BD Biosciences), anti-CD8 (clone: SK1, TruRed; BD Biosciences), anti-CD4 (clone: L200, PE-Cy7; BD Biosciences), anti-IFN-γ (clone: B27, FITC; BD Biosciences), and anti-TNF (clone: MAb11, APC; BD Biosciences). LIVE/DEAD Fixable Near Infra-Red Dead Cell Stain (Life Technologies) was used to assess cell viability. Sample collection was performed on an LSR-II instrument (BD Biosciences), and analysis was conducted with FlowJo software (Tree Star).

Ag-specific CD8+ T cells were identified and viable cells sorted using surface-trapped TNF-α staining (23). PBMCs, isolated CD8β+ T cells, or CD8+ T cell transductants were incubated with peptide-pulsed APCs, the costimulatory molecules CD28 and CD49d (BD Biosciences), anti-TNF (clone: MAb11, PE; BD Biosciences), and TAPI-0 (5 μM final concentration; Santa Cruz Biotechnology). Cells were incubated at 37°C for 8 h. After incubation, cells were stained anti-CD3 (clone: SP34-2, Pacific Blue; BD Biosciences), anti-CD8 (clone: SK1, TruRed; BD Biosciences), anti-CD4 (clone: L200, PE-Cy7; BD Biosciences), anti-CD14 (clone: M5E2, APC; BioLegend), anti-CD69 (FN50, FITC; BioLegend), anti-CD16 (clone: 3G8, APC; BioLegend), and anti-CD20 (clone: 2H7, APC; BioLegend), and LIVE/DEAD Fixable Near Infra-Red Dead Cell Stain (Life Technologies) was used to assess cell viability. Ag-specific cells were defined as TNF-α+/CD69+ CD8+ T cell responses two times the magnitude of the no peptide control, with the no peptide control responses below 0.5%. Viable Ag-specific cells were sorted using a FACSAria Fusion (BD Biosciences), and analysis was conducted with FlowJo software (Tree Star).

IFN-γ ELISPOT was performed on TCR transductants, similar to previously described methods (12, 22). Briefly, 10,000 BLCLs were incubated with 10 µM of the indicated peptide(s) for 90 min, washed three times with 1× PBS, and then combined with 5000–35,000 effectors. Results are reported as IFN-γ spot-forming cells (SFCs) per 1 × 104 effectors, following subtraction of duplicate wells with media only (negative control).

Viable CD8+ T cells were sorted into 20-μl chilled R10 media using a FACSAria Fusion (BD Biosciences). Sorted cells were loaded into a 10× Genomics Chromium instrument (10× Genomics) and processed using the Single Cell 5′ and V(D)J Enrichment Kit version 1.1 following the manufacturer’s protocol. Generation of gene expression libraries was performed using the manufacturer’s instructions. Generation of VDJ enriched libraries followed the manufacturer’s instructions, except that macaque-specific TCR C region primers were used in place of human-specific TCR enrichment primers. Enrichment was performed using two nested PCR reactions. The first enrichment PCR used the forward primer 5′- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ at a stock concentration of 1 μM, with reverse primers targeting the α and β constant regions: 5′- GTCTGCTGGAATAACGCTGTCC-3′ (1 μM stock concentration) and 5′- GCGCTGATCTTTTGGGTGATGG-3′ (0.5 μM stock concentration). The nested PCR used the forward primer 5′-AATGATACGGCGACCACCGAGATCT-3′ (1 μM stock concentration) and reverse primers targeting the α and β constant regions: 5′-ATGCACGTCAGAATCCTTGC-3′ (1 μM stock concentration) and 5′-CAGAAGGTGGCCGAGACC-3′ (0.5 μM stock concentration). In both cases the concentration of the α C region primer was increased relative to the β primer to improve capture. PCR conditions for both reactions were as follows: lid temperature 105°C; 98°C for 45 s; 12 cycles of 98°C for 20 s, 60°C for 30 s, and 72°C for 1 min; followed by 72°C for 1 min and 4°C hold. To multiplex samples, cell hashing was used, using the MULTI-seq lipid labeling system (45, 46). Sequence libraries were sequenced using Illumina chemistry, on either NovaSeq or HiSeq instruments (Illumina).

Raw sequence reads for gene expression and TCR enrichment were first processed using cellranger software, version 3.1 (10× Genomics). For TCR analyses, data were aligned using a custom macaque V/J segment library, developed by our group, available in repseqio format (47). This library was provided to the cellranger vdj software. The raw clonotype calls produced by cellranger vdj were extracted from the comma-delimited outputs. Cells were demultiplexed and TCR calls were assigned to samples using custom software, made publically available through the cellhashR package (46).

For clones of interest, near full-length V/J sequences were obtained by aligning the consensus sequences from multiple cells. The resulting consensus sequences were trimmed to the V/J open reading frame. Any internal EcoRI or NotI restriction sites were altered with single nucleotide substitutions that preserved the amino acid sequence, but removed the restriction site. For each clone, the macaque TRA and TRB V/J sequences were combined in silico with modified murine TRA and TRB constant regions, and separated by a P2A site (37). See Supplemental Table I for the full sequence of each construct. The resulting sequences were synthesized (Genscript), digested with EcoRI and NotI, and cloned into the pMP71 retroviral vector (48). This system has been previously described for T cell transduction (4850). Murine constant regions are used because they prevent pairing with endogenous TCR chains, and they have been modified to encode additional cysteine residues, thereby increasing the α/β C region binding affinity and thereby increasing TCR surface expression (37). This vector was used to transfect HEK293-based retroviral packaging cell line 293Vec-RD114 (provided by BioVec Pharma) using TransIT LT1 (Mirus Bio), following the manufacturer’s protocol. After 24 h, the transfection reagent was replaced with fresh medium, and supernatant was harvested 24 h later, centrifuged to remove debris, aliquoted, and frozen.

CD8+ T cell–enriched PBMCs were isolated from rhesus macaque PBMCs utilizing a nonhuman primate CD4 MicroBeads Kit (Miltenyi Biotec) according to the manufacturer’s instructions. Isolated cells were resuspended in X-Vivo-15 medium (Lonza) supplemented with 10% FBS and 500 U/ml IL-2 (Genscript). Cells were then stimulated with a nonhuman primate T Cell Activation/Expansion Kit (Miltenyi Biotec) in accordance with the manufacturer’s instructions. Cells were then incubated for 48 h at 37°C. Activated T cells were separated from T cell activation kit beads by centrifugation on a Ficoll (GE Healthcare) gradient. Cells were washed, resuspended in supplemented X-Vivo-15 medium, and plated in 24-well plates at 2 × 106 per milliliter.

RD114 TCR supernatants were thawed and centrifuged at 20,000 × g at 4°C for 1 h on a 20% sucrose (w/v) gradient. The supernatants were removed and residual volume and pellets were incubated with ViroMag beads (OzBiosciences) for 15 min at room temperature. Beads/RD114-pseudotyped retrovirus were then added to activated T cells and the plate was briefly spun at 1600 × g. The plate was then placed on top of the manufacturer’s magnet and incubated at 37°C with 5% CO2 for 15 min. Transduction efficiency was assessed two days postinfection by staining with anti-murine TCR β-chain Ab (clone: H57-957, PE; BioLegend). Cells were then expanded for 1 wk before assays were performed.

To validate whether the combination of surface-trapped TNF-α sorting (STTS), single-cell sequencing, and TCR transductants can rapidly identify and characterize Ag-specific CD8+ T cells, we first examined responses against RhCMV in two rhesus macaques. Virtually all rhesus macaques are naturally infected with RhCMV at a young age, generally mounting robust CD8+ T cell responses (51, 52).

PBMCs from each animal were stimulated ex vivo with peptide pools for CMV intermediate/early (IE) proteins 1 and 2, along with a no peptide control, using 1 million PBMCs per assay. We performed standard ICS in parallel with STTS. Incubation time and TAPI-0 concentration were determined using a separate time course experiment (Supplemental Fig. 1). The responses are shown in (Fig. 1A and (1B, with the magnitude of the responding cells indicated. The Rh-204C/IE-1 response was not above background (data not shown). It should be noted that although the frequency of CD69+/TNF-α+ cells detected using STTS was consistently lower than that of the corresponding ICS assay, which may be due to inefficient or incomplete capture of TNF-α, sufficient CD69+/TNF-α+ cells were detected to allow sorting. An evaluation of STTS sensitivity is shown in Supplemental Fig. 2.

FIGURE 1.

Identification of RhCMV-specific CD8+ T cell clonotypes. (A and B) PBMCs from two RhCMV+ rhesus macaques were stimulated ex vivo with 15mer peptide pools for either CMV IE-1 or IE-2, measured using ICS (top) or STTS (bottom). The Rh-204C IE-1 response was not above background (data not shown). (C and D) CD69+/TNF-α+ cells were live sorted from each response, followed by single-cell sequencing. Pie charts indicate the TCR clonotypic hierarchies of each response. (E) Table shows the V/J usage and CDR3 sequence for the paired α/β-chains of the four most common TCR clonotypes. The identity of the TRBD segment for TCR55 could not be unambiguously determined from the 9-NT region between the V- and J-segments.

FIGURE 1.

Identification of RhCMV-specific CD8+ T cell clonotypes. (A and B) PBMCs from two RhCMV+ rhesus macaques were stimulated ex vivo with 15mer peptide pools for either CMV IE-1 or IE-2, measured using ICS (top) or STTS (bottom). The Rh-204C IE-1 response was not above background (data not shown). (C and D) CD69+/TNF-α+ cells were live sorted from each response, followed by single-cell sequencing. Pie charts indicate the TCR clonotypic hierarchies of each response. (E) Table shows the V/J usage and CDR3 sequence for the paired α/β-chains of the four most common TCR clonotypes. The identity of the TRBD segment for TCR55 could not be unambiguously determined from the 9-NT region between the V- and J-segments.

Close modal

Sorted cells were single-cell sequenced using the 10× Genomics platform. Prior to sorting and concurrent with fluorescent Ab staining, we labeled each PBMC sample with nucleotide-barcoded lipids (termed “cell hashing”) (45, 53). This allows samples to be pooled, which can then be multiplexed and processed using a single 10× lane. This multiplexing capability dramatically reduces the cost per sample and is critical for throughput and feasibility of this approach. The resulting sequence data provided the TCR clonotypic hierarchies for each response (Fig. 1C, 1D). In each case, the response to a given protein was characterized by a small number of dominant clones. Critical for this system, TCR sequence data can be linked back to individual cells, thereby identifying the pairing of α/β-chains (Fig. 1E).

We selected the three most common IE-2 TCR clones for further characterization. The full-length macaque V/J regions of each TCR α/β pair were synthesized and cloned into a previously described retroviral expression system (4850). In this system, the macaque V/J regions are fused to modified murine constant regions (Fig. 2A). This provides two advantages: the murine constant regions prevent pairing between the exogenous and endogenous TCRs present on the donor cells; and the murine constant regions have point mutations to create additional disulfide bonds, increasing binding affinity and thereby increasing TCR surface expression (37). The complete nucleotide sequence of each TCR construct is shown in Supplemental Table I. CD8+ T cells from a macaque donor were transduced with these constructs to stably express either TCR51, TCR54, or TCR55. Surface expression of exogenous TCR can be monitored using Abs against the murine TCRβ C region, a further advantage of this approach (Fig. 2B).

FIGURE 2.

Characterization of RhCMV-specific TCRs using transductants. (A) Schematic of the chimeric macaque V/J, murine C region (“murinized”) TCR receptor. (B) Representative flow plot of CD8+ T cells from a donor macaque, with or without transduction of TCR54, illustrating the detection of surface murine TCRβ in transduced cells. (C) Transductants expressing TCR51 (black), TCR54 (blue), or TCR55 (red) were incubated with BLCL pulsed with the indicated 15mer IE-2 peptide pools, followed by IFN-γ ELISPOT. Bars indicate the SFCs per 5 × 104 cells, after background subtraction. (D) Similar graph to (C) showing transductants stimulated with the 10 individual 15mer peptides from IE-2 Pool H. (E and F) Peptide titration experiments were performed to determine the minimal/optimal peptide sequence, using overlapping 9mer and 10mer peptides spanning IE-2 residues 313–322. BLCLs were pulsed with each of the peptides indicated in (F), at varying concentrations, followed by incubation with transductants expressing either TCR51 (E) or TCR54 (F). Graphs indicate the SFCs per 5 × 104 cells, measured by IFN-γ ELISPOT. (G) Transductants expressing either TCR51 (black), TCR54 (blue), or nontransduced (green) were incubated with the indicated APCs, pulsed with AN10 peptide (IE-2313–322). Rh-A02 BLCL is from a Mamu-A*02 positive animal. No MHC-I denotes the parent MHC-null K562 cells. A*01, A*02, and B*08 denote K562 cell lines expressing the indicated MHC class Ia allele. Graph indicates the percentage of murine TCRβ+ cells positive for TNF-α and IFN-γ, measured by flow cytometric ICS.

FIGURE 2.

Characterization of RhCMV-specific TCRs using transductants. (A) Schematic of the chimeric macaque V/J, murine C region (“murinized”) TCR receptor. (B) Representative flow plot of CD8+ T cells from a donor macaque, with or without transduction of TCR54, illustrating the detection of surface murine TCRβ in transduced cells. (C) Transductants expressing TCR51 (black), TCR54 (blue), or TCR55 (red) were incubated with BLCL pulsed with the indicated 15mer IE-2 peptide pools, followed by IFN-γ ELISPOT. Bars indicate the SFCs per 5 × 104 cells, after background subtraction. (D) Similar graph to (C) showing transductants stimulated with the 10 individual 15mer peptides from IE-2 Pool H. (E and F) Peptide titration experiments were performed to determine the minimal/optimal peptide sequence, using overlapping 9mer and 10mer peptides spanning IE-2 residues 313–322. BLCLs were pulsed with each of the peptides indicated in (F), at varying concentrations, followed by incubation with transductants expressing either TCR51 (E) or TCR54 (F). Graphs indicate the SFCs per 5 × 104 cells, measured by IFN-γ ELISPOT. (G) Transductants expressing either TCR51 (black), TCR54 (blue), or nontransduced (green) were incubated with the indicated APCs, pulsed with AN10 peptide (IE-2313–322). Rh-A02 BLCL is from a Mamu-A*02 positive animal. No MHC-I denotes the parent MHC-null K562 cells. A*01, A*02, and B*08 denote K562 cell lines expressing the indicated MHC class Ia allele. Graph indicates the percentage of murine TCRβ+ cells positive for TNF-α and IFN-γ, measured by flow cytometric ICS.

Close modal

Next, we sought to map the RhCMV epitopes recognized by each clone, using these TCR transductants. Because both animals express the high-frequency allele Mamu-A*02, we selected a pre-existing BLCL from a Mamu-A*02+ donor (animal Rh-A02) to use for Ag presentation. We stimulated each transductant using these BLCLs pulsed with CMV IE-2 overlapping 15mer pools, followed by IFN-γ ELISPOT. For each transductant, we detected the strongest response to peptide Pool H (Fig. 2C). We then performed similar experiments in which each transductant was stimulated using the same BLCLs pulsed with each of the 10 individual 15mer peptides from Pool H, followed by IFN-γ ELISPOT. All three TCR transductants responded most strongly to two overlapping 15mer peptides, IE-2313–327 and IE-2309–323 (Fig. 2D). To map the minimal optimal epitope, we next stimulated TCR51 and TCR54 transductants using BLCLs pulsed with the overlapping 9mer and 10mer peptides from this region, using decreasing concentrations, measured by IFN-γ ELISPOT. Peptide AN10 (ATTRSLEYKN, IE-2313–322) showed the highest affinity throughout the dilution series (Fig. 2E, 2F). Finally, to verify the restricting MHC class Ia allele, transductants expressing TCR51, TCR54, or nontransduced cells were incubated with a panel of APCs, each encoding a different MHC class Ia allele, pulsed with AN10 peptide (Fig. 2G). Only Rh-A02 BLCL (a Mamu-A*02+ animal), and K562 cells expressing Mamu-A*02 induced a response, measured by ICS (Fig. 2G). No response was detected in the control MHC class Ia K562 cells, the no peptide control, or in K562 cells expressing either Mamu-A*01 or Mamu-B*008:01 (Mamu-B*08). From these data we concluded that the dominant CMV IE-2 CD8+ T cell clones from both Rh-204C and Rh-200A each recognize the peptide IE-2 AN10, presented by Mamu-A*02.

We next sought to verify whether the in vitro transductant results mirrored the endogenous CD8+ T cells. We constructed an MHC class I tetramer using Mamu-A*02 and AN10. We used this tetramer to stain PBMCs from Rh-204C and Rh-200A (Fig. 3A). Tetramer-positive cells were live sorted, followed by single-cell sequencing. Tetramer sorting identified the same dominant clones, TCR51, TCR54, and TCR55, demonstrating that the in vitro transductant experiments identified the correct epitope. To further validate our results, PBMCs from Rh-204C and Rh-200A were stimulated ex vivo with AN10 peptide using STTS. Responding cells were sorted and single-cell sequenced. These experiments identified the expected TCR clones (TCR51, TCR54, and TCR55), demonstrating that primary cells are capable of cytokine production following AN10 stimulation (Fig. 3B). It should be noted that in this assay TCR51 was detected at a much lower frequency than that detected by tetramer sorting, with TCR55 representing a greater fraction of cytokine-producing cells. Although this could represent assay-to-assay variation, it has been reported that not all tetramer-positive cells have the potential to produce TNF-α. Tetramer staining can therefore identify a superset of cells relative to TNF-α–based detection methods (23). Of note, although the Rh-200A IE-2 response was dominated by TCR54, the minor clone CASSSRPGLPGQETQYF (denoted with ** in (Fig. 3A) was also detected in the previous IE-2 ORF STTS (Fig. 1), which suggests AN10 dominates the CMV IE-2 response in this animal. Collectively, these data demonstrate that the AN10 epitope, which was identified in vitro using TCR transductants, is the biologically relevant Ag and that AN10-specific CD8 T cells represent the majority of the CMV IE-2 CD8+ T cell response in both Rh-204C and Rh-200A.

FIGURE 3.

Ex vivo validation of IE-2 AN10. (A) MHC tetramers were folded using Mamu-A*02 and IE-2 AN10, and then used to stain PBMCs from Rh-204C and Rh-200A. Flow plots indicate the fraction of CD8+ T cells stained by AN10 tetramers for each animal. The tetramer-positive cells were live sorted, followed by single-cell sequencing. Pie charts indicate the clonotypic hierarchies for each, demonstrating that the clones previously identified by IE-1/2 ORF peptide stimulations are present. (B) PBMCs from Rh-204C and Rh-200A were stimulated ex vivo with AN10 peptide, followed by STTS. Pie charts indicate the clonotypic hierarchies, demonstrating that primary cells stimulated with AN10 recapitulate the transductant experiments. (C) To further validate the AN10 response, and to evaluate its prevalence in the broader rhesus macaque population, we performed IFN-γ ELISPOT using animals cells from three groups: RhCMV/Mamu-A*02+, RhCMV+/Mamu-A*02, and RhCMV+/Mamu-A*02+. Cells were stimulated with either CMV lysate (left), or AN10 peptide (right). Graphs indicate SFCs per 5 × 104 cells (*p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001).

FIGURE 3.

Ex vivo validation of IE-2 AN10. (A) MHC tetramers were folded using Mamu-A*02 and IE-2 AN10, and then used to stain PBMCs from Rh-204C and Rh-200A. Flow plots indicate the fraction of CD8+ T cells stained by AN10 tetramers for each animal. The tetramer-positive cells were live sorted, followed by single-cell sequencing. Pie charts indicate the clonotypic hierarchies for each, demonstrating that the clones previously identified by IE-1/2 ORF peptide stimulations are present. (B) PBMCs from Rh-204C and Rh-200A were stimulated ex vivo with AN10 peptide, followed by STTS. Pie charts indicate the clonotypic hierarchies, demonstrating that primary cells stimulated with AN10 recapitulate the transductant experiments. (C) To further validate the AN10 response, and to evaluate its prevalence in the broader rhesus macaque population, we performed IFN-γ ELISPOT using animals cells from three groups: RhCMV/Mamu-A*02+, RhCMV+/Mamu-A*02, and RhCMV+/Mamu-A*02+. Cells were stimulated with either CMV lysate (left), or AN10 peptide (right). Graphs indicate SFCs per 5 × 104 cells (*p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001).

Close modal

To provide additional validation of the AN10 epitope and to measure the frequency of this response in the ONPRC colony, we screened three additional cohorts: RhCMV+/Mamu-A*02+ animals, RhCMV+/Mamu-A*02 animals, and RhCMV/Mamu-A*02+ animals. The latter were selected from the ONPRC enhanced-specific pathogen free colony, and have been verified to be RhCMV (23). As expected, all RhCMV+ animals had a robust ELISPOT response to CMV lysate, relative to RhCMV animals (Fig. 3C). When stimulated with AN10 peptide, only PBMCs from RhCMV+/Mamu-A*02+ animals responded, as would be expected for an epitope restricted by Mamu*A*02. In addition to validating our system as a rapid method for epitope identification, it is worth noting that virtually all Mamu-A*02+ animals we tested (8/9) responded to AN10. Because such a high fraction of Mamu-A*02+ animals mount this response, it may be of experimental interest either in the study of RhCMV or as a control CD8+ T cell response for use in other disease studies.

We next turned to an HIV-infected human donor, representing a sample with limited primary cells. Following a similar strategy as the macaque experiments, we initially stimulated PBMCs ex vivo with HIV-1 Clade B Gag peptide pools, followed by IFN-γ ELISPOT (Fig. 4A, 4B). These experiments consumed 1 million primary PBMCs per pool. Although multiple peptide pools produced responses above background, we selected Pool E for further characterization. As before, we performed STTS using 1 million PBMCs, live sorted the responding cells, and performed single-cell sequencing (Fig. 4B). The TCR repertoire to this peptide pool was dominated by one major clone: 1247-TCR-1 (Fig. 4C, 4D). We synthesized this clone and inserted it into the same expression vector as before, expressing the human V/J segments fused to modified murine constant regions (Fig. 2A). This construct was used to generate retrovirus and transduce CD8+ T cells from an HIV-naive donor (Fig. 4E). We next sought to map the minimal epitope for this clone, following the same approach as the rhesus macaque experiments. TCR transductants expressing 1247-TCR-1 were stimulated in vitro using autologous BLCL peptide pulsed with the individual 15mer peptides from Gag Pool E, identifying Gag165–179 (SA15) as the strongest response (Fig. 4F). We next performed two sets of experiments in parallel. To identify the minimal optimal epitope, we stimulated 1247-TCR-1 transductants with autologous BLCL pulsed with the 9mer and 10mer peptides overlapping SA15, followed by IFN-γ ELISPOT (Fig. 4G). This identified EL9 (EVIPMFSAL, Gag167–175) as the minimal optimal peptide. Finally, we sought to identify the restricting HLA allele. We performed flow cytometric ICS with a panel of MHC class I null 0.221 cells, with each expressing a single HLA allele present in the donor: HLA-A*32:01, HLA-A*68:02, HLA-B*39:10, HLA-B*53:01, HLA-Cw*04:01, and HLA-Cw*14:03. These APCs were pulsed with the SA15 peptide and incubated with 1247-TCR-1 transductants, followed by ICS (Fig. 4H). The only APCs to elicit a response above background were cells expressing HLA-A*68:02, identifying HLA-A*68:02 as the presenting HLA allele. We subsequently peptide pulsed 0.221 cells expressing HLA-A*68:02 with either SA15 or the minimal epitope EL9, followed by incubation with 1247-TCR-1 transductants and ICS (Supplemental Fig. 3). As expected, the minimal optimal EL9 peptide elicited a nearly 2-fold higher response.

FIGURE 4.

Identification and characterization of a novel HIV Gag epitope. (A) PBMCs from an HIV-infected donor, SCOPE 1247, were stimulated ex vivo with HIV Gag 15mer peptide pools. Graph indicates the frequency of responding cells, measured by IFN-γ ELISPOT. Dotted line indicates the limit of quantitation (LOQ; 50 SFCs per 105 CD8+ T cells). (B) Flow plot for STTS using SCOPE 1247 PBMCs, pulsed with HIV-1 Gag Clade B Pool E. The CD69+/TNF-α+ cells were live cell sorted, followed by single-cell sequencing. (C) Pie chart indicates the TCR clonotypic hierarchy of CD8+ T cells activated by Pool E peptide, demonstrating one major clone, 1247-TCR-1, comprises the majority of the response. (D) Table shows the paired α/β-chains from clone 1247-TCR-1. (E) The α/β-chains from 1247-TCR-1 were synthesized and used to transduce donor CD8+ T cells. The flow plot shows the fraction of cells stained for murine TCRβ, indicating cell surface expression of exogenous 1247-TCR-1. (F) IFN-γ ELISPOT was performed using 1247-TCR-1 transductants stimulated with autologous BLCL, pulsed with each of the peptides comprising HIV Gag Pool E (LOQ = 5 SFCs per 104 cells). The strongest response was detected from Gag165–179 (SA15). (G) ELISPOT was performed using autologous BLCL pulsed with the indicated 9mer and 10mer peptides, which overlap SA15. The strongest response was detected from EVIPMFSAL (EL9). (H) To determine HLA-restriction, 1247-TCR-1 transductants were incubated with 0.221 cell lines individually expressing each of the HLA alleles encoded by the patient, pulsed with SA15 peptide. Cells expressing HLA-A*68:02 were the only APCs that produced a response above background, measured by ICS.

FIGURE 4.

Identification and characterization of a novel HIV Gag epitope. (A) PBMCs from an HIV-infected donor, SCOPE 1247, were stimulated ex vivo with HIV Gag 15mer peptide pools. Graph indicates the frequency of responding cells, measured by IFN-γ ELISPOT. Dotted line indicates the limit of quantitation (LOQ; 50 SFCs per 105 CD8+ T cells). (B) Flow plot for STTS using SCOPE 1247 PBMCs, pulsed with HIV-1 Gag Clade B Pool E. The CD69+/TNF-α+ cells were live cell sorted, followed by single-cell sequencing. (C) Pie chart indicates the TCR clonotypic hierarchy of CD8+ T cells activated by Pool E peptide, demonstrating one major clone, 1247-TCR-1, comprises the majority of the response. (D) Table shows the paired α/β-chains from clone 1247-TCR-1. (E) The α/β-chains from 1247-TCR-1 were synthesized and used to transduce donor CD8+ T cells. The flow plot shows the fraction of cells stained for murine TCRβ, indicating cell surface expression of exogenous 1247-TCR-1. (F) IFN-γ ELISPOT was performed using 1247-TCR-1 transductants stimulated with autologous BLCL, pulsed with each of the peptides comprising HIV Gag Pool E (LOQ = 5 SFCs per 104 cells). The strongest response was detected from Gag165–179 (SA15). (G) ELISPOT was performed using autologous BLCL pulsed with the indicated 9mer and 10mer peptides, which overlap SA15. The strongest response was detected from EVIPMFSAL (EL9). (H) To determine HLA-restriction, 1247-TCR-1 transductants were incubated with 0.221 cell lines individually expressing each of the HLA alleles encoded by the patient, pulsed with SA15 peptide. Cells expressing HLA-A*68:02 were the only APCs that produced a response above background, measured by ICS.

Close modal

Of interest, the EL9 peptide has been described in prior studies as an HLA-A*26-restricted response, and this peptide has been included in a commonly used ELISPOT screening panel (10, 5458). To test whether 1247-TCR-1 could recognize EL9 bound by HLA-A*26, we generated 0.221 cells expressing either HLA-A*68:02 or HLA-A*26:01. These APCs were pulsed with EL9 peptide and incubated with 1247-TCR-1 transductants, followed by ICS (Supplemental Fig. 3). The HLA-A*26:01–expressing cells did not elicit a response above background, indicating that even if EL9 can be presented by HLA-A*26:01, it is not recognized by 1247-TCR-1. Our data nonetheless demonstrate this Gag epitope can be presented by multiple HLA alleles.

Here we present a novel scheme to characterize Ag-specific CD8+ T cells and their cognate MHC Ags. This system combines three components: 1) high sensitivity TNF-α capture to identify and isolate viable Ag-specific cells, 2) massively parallel single-cell resolution sequencing to identify the complete clonotypic hierarchy of each response, and 3) exogenous expression of the TCR α/β pair on donor cells. The latter produces a nearly unlimited experimental reagent that can be used for in vitro validation and characterization, without depleting primary cells. We demonstrate this system accurately identifies and characterizes Ag-specific CD8+ T cells in both CMV-infected rhesus macaques and an HIV-infected donor, identifying the antigenic peptides and restricting MHC alleles for each. We validated our results using primary cells, demonstrating the in vitro system recapitulates endogenous TCR/MHC interactions.

This system has a wide range of applications. It provides a clear advantage whenever patient/donor samples are limited. This approach requires as little as one experiment with primary cells: the STTS screen to identify Ag-specific TCR sequences. Even when samples are not limited, such as most studies using animal models, the transductant system may have benefits. For example, it could facilitate epitope mapping when the host response is weak or rare. In some contexts, the primary CD8+ T cell response to a given Ag may be difficult to culture in vitro, such as the terminally differentiated CD8+ T cell responses elicited by CMV vaccine vectors (39, 43). The identification of the TCR sequences, followed by expression in transductants may facilitate study of these T cells. The rapid generation and characterization of patient-specific T cell responses and their cognate Ags has clear applications for the creation of personalized immunotherapeutics as well.

The system is premised on CD8+ T cell Ag specificity being conferred nearly exclusively through the TCR and cognate MHC-bound peptide. Exogenous expression of the specific TCR α/β pair on donor cells is generally sufficient for antigenic recognition, as we demonstrate in this study and has been previously published (35, 37, 5962). There are nonetheless examples of other receptors and signaling pathways that modulate CD8+ T cell specificity and activation (63, 64). Potentially interesting extensions of the system we present in this study could involve careful selection or experimental manipulation of the donor CD8+ T cells, either to control the genetic background, or to perform overexpression or knockout of other signaling molecules.

Together, this study validates a novel system to rapidly identify CD8+ T cells and their peptide/MHC Ags. We demonstrate that limited experiments with primary cells can accurately identify the TCR sequences of Ag-specific CD8+ T cells, these sequences can be cloned into donor cells to recapitulate Ag specificity of the primary cells, and this in vitro system provides a surrogate to accurately characterize the primary CD8+ T cell response. This scheme is well suited to any situation where primary cells are rare or not amenable to ex vivo functional studies, with a range of practical applications.

We thank Dr. Chris McGinnis for generously providing MULTI-seq barcoded lipids.

This work was supported by National Institute of Allergy and Infectious Diseases Grants R01 AI140888 and R01 AI129703 (to J.B. Sacha), and Grant R01 AI059457 (to K.F.), by National Institutes of Health Office of the Director Grant K01 OD029804 (to S.A.), by the German Research Foundation via SFB-TRR 338, Grant 452881907, Project B7 (to U.P.), and by U.S. Department of Defense Grant W81XWH_19_10358 (to K.F.). This project has been funded in part with federal funds from the Frederick National Laboratory for Cancer Research, under Contract Number HHSN261200800001E. The SCOPE cohort was supported by the University of California, San Francisco/Gladstone Institute of Virology and Immunology Center for AIDS Research (Grant P30 AI027763) and the Center for AIDS Research Network of Integrated Systems (Grant R24 AI067039).

The online version of this article contains supplemental material.

Abbreviations used in this article

BLCL

B-lymphoblastoid cell line

ICS

intracellular cytokine staining

ONPRC

Oregon National Primate Research Center

RhCMV

rhesus CMV

SCOPE

Study of the Consequences of the Protease Inhibitor Era

SFC

spot-forming cell

STTS

surface-trapped TNF-α sorting

1.
Appay
V.
,
D. C.
Douek
,
D. A.
Price
.
2008
.
CD8+ T cell efficacy in vaccination and disease.
Nat. Med.
14
:
623
628
.
2.
Schreiber
R. D.
,
L. J.
Old
,
M. J.
Smyth
.
2011
.
Cancer immunoediting: integrating immunity’s roles in cancer suppression and promotion.
Science
331
:
1565
1570
.
3.
Turner
S. J.
,
P. C.
Doherty
,
J.
McCluskey
,
J.
Rossjohn
.
2006
.
Structural determinants of T-cell receptor bias in immunity.
Nat. Rev. Immunol.
6
:
883
894
.
4.
Siggs
O. M.
,
L. E.
Makaroff
,
A.
Liston
.
2006
.
The why and how of thymocyte negative selection.
Curr. Opin. Immunol.
18
:
175
183
.
5.
Gras
S.
,
S. R.
Burrows
,
S. J.
Turner
,
A. K.
Sewell
,
J.
McCluskey
,
J.
Rossjohn
.
2012
.
A structural voyage toward an understanding of the MHC-I-restricted immune response: lessons learned and much to be learned.
Immunol. Rev.
250
:
61
81
.
6.
Sharma
G.
,
R. A.
Holt
.
2014
.
T-cell epitope discovery technologies.
Hum. Immunol.
75
:
514
519
.
7.
Dornmair
K.
,
E.
Meinl
,
R.
Hohlfeld
.
2009
.
Novel approaches for identifying target antigens of autoreactive human B and T cells.
Semin. Immunopathol.
31
:
467
477
.
8.
Boon
A. C.
,
G.
de Mutsert
,
Y. M.
Graus
,
R. A.
Fouchier
,
K.
Sintnicolaas
,
A. D.
Osterhaus
,
G. F.
Rimmelzwaan
.
2002
.
The magnitude and specificity of influenza A virus-specific cytotoxic T-lymphocyte responses in humans is related to HLA-A and -B phenotype.
J. Virol.
76
:
582
590
.
9.
McMichael
A. J.
,
F. M.
Gotch
,
J.
Rothbard
.
1986
.
HLA B37 determines an influenza A virus nucleoprotein epitope recognized by cytotoxic T lymphocytes.
J. Exp. Med.
164
:
1397
1406
.
10.
Altfeld
M.
,
E. T.
Kalife
,
Y.
Qi
,
H.
Streeck
,
M.
Lichterfeld
,
M. N.
Johnston
,
N.
Burgett
,
M. E.
Swartz
,
A.
Yang
,
G.
Alter
, et al
2006
.
HLA alleles associated with delayed progression to AIDS contribute strongly to the initial CD8+ T cell response against HIV-1.
PLoS Med.
3
:
e403
.
11.
Goulder
P. J.
,
R. E.
Phillips
,
R. A.
Colbert
,
S.
McAdam
,
G.
Ogg
,
M. A.
Nowak
,
P.
Giangrande
,
G.
Luzzi
,
B.
Morgan
,
A.
Edwards
, et al
1997
.
Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS.
Nat. Med.
3
:
212
217
.
12.
Freer
G.
,
L.
Rindi
.
2013
.
Intracellular cytokine detection by fluorescence-activated flow cytometry: basic principles and recent advances.
Methods
61
:
30
38
.
13.
Newell
E. W.
,
W.
Lin
.
2014
.
High-dimensional analysis of human CD8+ T cell phenotype, function, and antigen specificity.
Curr. Top. Microbiol. Immunol.
377
:
61
84
.
14.
Waldrop
S. L.
,
C. J.
Pitcher
,
D. M.
Peterson
,
V. C.
Maino
,
L. J.
Picker
.
1997
.
Determination of antigen-specific memory/effector CD4+ T cell frequencies by flow cytometry: evidence for a novel, antigen-specific homeostatic mechanism in HIV-associated immunodeficiency.
J. Clin. Invest.
99
:
1739
1750
.
15.
Hansen
S. G.
,
J. C.
Ford
,
M. S.
Lewis
,
A. B.
Ventura
,
C. M.
Hughes
,
L.
Coyne-Johnson
,
N.
Whizin
,
K.
Oswald
,
R.
Shoemaker
,
T.
Swanson
, et al
2011
.
Profound early control of highly pathogenic SIV by an effector memory T-cell vaccine.
Nature
473
:
523
527
.
16.
Altman
J. D.
,
P. A.
Moss
,
P. J.
Goulder
,
D. H.
Barouch
,
M. G.
McHeyzer-Williams
,
J. I.
Bell
,
A. J.
McMichael
,
M. M.
Davis
.
1996
.
Phenotypic analysis of antigen-specific T lymphocytes.
Science
274
:
94
96
.
17.
Wooldridge
L.
,
A.
Lissina
,
D. K.
Cole
,
H. A.
van den Berg
,
D. A.
Price
,
A. K.
Sewell
.
2009
.
Tricks with tetramers: how to get the most from multimeric peptide-MHC.
Immunology
126
:
147
164
.
18.
Campbell
J. D
.
2003
.
Detection and enrichment of antigen-specific CD4+ and CD8+ T cells based on cytokine secretion.
Methods
31
:
150
159
.
19.
Brosterhus
H.
,
S.
Brings
,
H.
Leyendeckers
,
R. A.
Manz
,
S.
Miltenyi
,
A.
Radbruch
,
M.
Assenmacher
,
J.
Schmitz
.
1999
.
Enrichment and detection of live antigen-specific CD4+ and CD8+ T cells based on cytokine secretion.
Eur. J. Immunol.
29
:
4053
4059
.
20.
Douek
D. C.
,
J. M.
Brenchley
,
M. R.
Betts
,
D. R.
Ambrozak
,
B. J.
Hill
,
Y.
Okamoto
,
J. P.
Casazza
,
J.
Kuruppu
,
K.
Kunstman
,
S.
Wolinsky
, et al
2002
.
HIV preferentially infects HIV-specific CD4+ T cells.
Nature
417
:
95
98
.
21.
Lichterfeld
M.
,
X. G.
Yu
,
M. T.
Waring
,
S. K.
Mui
,
M. N.
Johnston
,
D.
Cohen
,
M. M.
Addo
,
J.
Zaunders
,
G.
Alter
,
E.
Pae
, et al
2004
.
HIV-1-specific cytotoxicity is preferentially mediated by a subset of CD8+ T cells producing both interferon-gamma and tumor necrosis factor-alpha.
Blood
104
:
487
494
.
22.
Crowe
P. D.
,
B. N.
Walter
,
K. M.
Mohler
,
C.
Otten-Evans
,
R. A.
Black
,
C. F.
Ware
.
1995
.
A metalloprotease inhibitor blocks shedding of the 80-kD TNF receptor and TNF processing in T lymphocytes.
J. Exp. Med.
181
:
1205
1210
.
23.
Haney
D.
,
M. F.
Quigley
,
T. E.
Asher
,
D. R.
Ambrozak
,
E.
Gostick
,
D. A.
Price
,
D. C.
Douek
,
M. R.
Betts
.
2011
.
Isolation of viable antigen-specific CD8+ T cells based on membrane-bound tumor necrosis factor (TNF)-α expression.
J. Immunol. Methods
369
:
33
41
.
24.
Goepfert
P. A.
,
A.
Bansal
,
B. H.
Edwards
,
G. D.
Ritter
Jr.
,
I.
Tellez
,
S. A.
McPherson
,
S.
Sabbaj
,
M. J.
Mulligan
.
2000
.
A significant number of human immunodeficiency virus epitope-specific cytotoxic T lymphocytes detected by tetramer binding do not produce gamma interferon.
J. Virol.
74
:
10249
10255
.
25.
Chattopadhyay
P. K.
,
J. J.
Melenhorst
,
K.
Ladell
,
E.
Gostick
,
P.
Scheinberg
,
A. J.
Barrett
,
L.
Wooldridge
,
M.
Roederer
,
A. K.
Sewell
,
D. A.
Price
.
2008
.
Techniques to improve the direct ex vivo detection of low frequency antigen-specific CD8+ T cells with peptide-major histocompatibility complex class I tetramers.
Cytometry A
73A
:
1001
1009
.
26.
Rosati
E.
,
C. M.
Dowds
,
E.
Liaskou
,
E. K. K.
Henriksen
,
T. H.
Karlsen
,
A.
Franke
.
2017
.
Overview of methodologies for T-cell receptor repertoire analysis.
BMC Biotechnol.
17
:
61
.
27.
Lin
H.
,
Y.
Peng
,
X.
Chen
,
Y.
Liang
,
G.
Tian
,
J.
Yang
.
2020
.
T cell receptor repertoire sequencing.
Methods Mol. Biol.
2204
:
3
12
.
28.
Gupta
S.
,
R.
Witas
,
A.
Voigt
,
T.
Semenova
,
C. Q.
Nguyen
.
2020
.
Single-cell sequencing of T cell receptors: a perspective on the technological development and translational application.
Adv. Exp. Med. Biol.
1255
:
29
50
.
29.
Macosko
E. Z.
,
A.
Basu
,
R.
Satija
,
J.
Nemesh
,
K.
Shekhar
,
M.
Goldman
,
I.
Tirosh
,
A. R.
Bialas
,
N.
Kamitaki
,
E. M.
Martersteck
, et al
2015
.
Highly parallel genome-wide expression profiling of individual cells using nanoliter droplets.
Cell
161
:
1202
1214
.
30.
See
P.
,
J.
Lum
,
J.
Chen
,
F.
Ginhoux
.
2018
.
A single-cell sequencing guide for immunologists.
Front. Immunol.
9
:
2425
.
31.
Zheng
G. X.
,
J. M.
Terry
,
P.
Belgrader
,
P.
Ryvkin
,
Z. W.
Bent
,
R.
Wilson
,
S. B.
Ziraldo
,
T. D.
Wheeler
,
G. P.
McDermott
,
J.
Zhu
, et al
2017
.
Massively parallel digital transcriptional profiling of single cells.
Nat. Commun.
8
:
14049
.
32.
Phetsouphanh
C.
,
J. J.
Zaunders
,
A. D.
Kelleher
.
2015
.
Detecting antigen-specific T cell responses: from bulk populations to single cells.
Int. J. Mol. Sci.
16
:
18878
18893
.
33.
Schumacher
T. N
.
2002
.
T-cell-receptor gene therapy.
Nat. Rev. Immunol.
2
:
512
519
.
34.
Kershaw
M. H.
,
M. W.
Teng
,
M. J.
Smyth
,
P. K.
Darcy
.
2005
.
Supernatural T cells: genetic modification of T cells for cancer therapy.
Nat. Rev. Immunol.
5
:
928
940
.
35.
Zhao
Y.
,
Z.
Zheng
,
P. F.
Robbins
,
H. T.
Khong
,
S. A.
Rosenberg
,
R. A.
Morgan
.
2005
.
Primary human lymphocytes transduced with NY-ESO-1 antigen-specific TCR genes recognize and kill diverse human tumor cell lines.
J. Immunol.
174
:
4415
4423
.
36.
Leisegang
M.
,
B.
Engels
,
P.
Meyerhuber
,
E.
Kieback
,
D.
Sommermeyer
,
S. A.
Xue
,
S.
Reuss
,
H.
Stauss
,
W.
Uckert
.
2008
.
Enhanced functionality of T cell receptor-redirected T cells is defined by the transgene cassette.
J. Mol. Med. (Berl.)
86
:
573
583
.
37.
Cohen
C. J.
,
Y.
Zhao
,
Z.
Zheng
,
S. A.
Rosenberg
,
R. A.
Morgan
.
2006
.
Enhanced antitumor activity of murine-human hybrid T-cell receptor (TCR) in human lymphocytes is associated with improved pairing and TCR/CD3 stability.
Cancer Res.
66
:
8878
8886
.
38.
Čičin-Šain
L.
,
A. W.
Sylwester
,
S. I.
Hagen
,
D. C.
Siess
,
N.
Currier
,
A. W.
Legasse
,
M. B.
Fischer
,
C. W.
Koudelka
,
M. K.
Axthelm
,
J.
Nikolich-Zugich
,
L. J.
Picker
.
2011
.
Cytomegalovirus-specific T cell immunity is maintained in immunosenescent rhesus macaques.
J. Immunol.
187
:
1722
1732
.
39.
Hansen
S. G.
,
J. B.
Sacha
,
C. M.
Hughes
,
J. C.
Ford
,
B. J.
Burwitz
,
I.
Scholz
,
R. M.
Gilbride
,
M. S.
Lewis
,
A. N.
Gilliam
,
A. B.
Ventura
, et al
2013
.
Cytomegalovirus vectors violate CD8+ T cell epitope recognition paradigms.
Science
340
:
1237874
.
40.
Voss
G.
,
S.
Nick
,
C.
Stahl-Hennig
,
K.
Ritter
,
G.
Hunsmann
.
1992
.
Generation of macaque B lymphoblastoid cell lines with simian Epstein-Barr-like viruses: transformation procedure, characterization of the cell lines and occurrence of simian foamy virus.
J. Virol. Methods
39
:
185
195
.
41.
Sugden
B.
,
W.
Mark
.
1977
.
Clonal transformation of adult human leukocytes by Epstein-Barr virus.
J. Virol.
23
:
503
508
.
42.
Garcia-Beltran
W. F.
,
A.
Hölzemer
,
G.
Martrus
,
A. W.
Chung
,
Y.
Pacheco
,
C. R.
Simoneau
,
M.
Rucevic
,
P. A.
Lamothe-Molina
,
T.
Pertel
,
T. E.
Kim
, et al
2016
.
Open conformers of HLA-F are high-affinity ligands of the activating NK-cell receptor KIR3DS1.
Nat. Immunol.
17
:
1067
1074
.
43.
Hansen
S. G.
,
H. L.
Wu
,
B. J.
Burwitz
,
C. M.
Hughes
,
K. B.
Hammond
,
A. B.
Ventura
,
J. S.
Reed
,
R. M.
Gilbride
,
E.
Ainslie
,
D. W.
Morrow
, et al
2016
.
Broadly targeted CD8+ T cell responses restricted by major histocompatibility complex E.
Science
351
:
714
720
.
44.
Abdulhaqq
S. A.
,
H.
Wu
,
J. B.
Schell
,
K. B.
Hammond
,
J. S.
Reed
,
A. W.
Legasse
,
M. K.
Axthelm
,
B. S.
Park
,
A.
Asokan
,
K.
Früh
, et al
2019
.
Vaccine-mediated inhibition of the transporter associated with antigen processing is insufficient to induce major histocompatibility complex E-restricted CD8+ T cells in nonhuman primates.
J. Virol.
93
:
e00592-19
.
45.
McGinnis
C. S.
,
D. M.
Patterson
,
J.
Winkler
,
D. N.
Conrad
,
M. Y.
Hein
,
V.
Srivastava
,
J. L.
Hu
,
L. M.
Murrow
,
J. S.
Weissman
,
Z.
Werb
, et al
2019
.
MULTI-seq: sample multiplexing for single-cell RNA sequencing using lipid-tagged indices.
Nat. Methods
16
:
619
626
.
46.
Boggy
G.
,
B. N.
Bimber
.
2021
.
cellhashR: an R package designed to demultiplex cell hashing data.
47.
Bimber
B
.
2021
.
Rhesus macaque V/J segment library.
48.
Engels
B.
,
H.
Cam
,
T.
Schüler
,
S.
Indraccolo
,
M.
Gladow
,
C.
Baum
,
T.
Blankenstein
,
W.
Uckert
.
2003
.
Retroviral vectors for high-level transgene expression in T lymphocytes.
Hum. Gene Ther.
14
:
1155
1168
.
49.
Wisskirchen
K.
,
K.
Metzger
,
S.
Schreiber
,
T.
Asen
,
L.
Weigand
,
C.
Dargel
,
K.
Witter
,
E.
Kieback
,
M. F.
Sprinzl
,
W.
Uckert
, et al
2017
.
Isolation and functional characterization of hepatitis B virus-specific T-cell receptors as new tools for experimental and clinical use.
PLoS One
12
:
e0182936
.
50.
Wisskirchen
K.
,
J.
Kah
,
A.
Malo
,
T.
Asen
,
T.
Volz
,
L.
Allweiss
,
J. M.
Wettengel
,
M.
Lütgehetmann
,
S.
Urban
,
T.
Bauer
, et al
2019
.
T cell receptor grafting allows virological control of hepatitis B virus infection.
J. Clin. Invest.
129
:
2932
2945
.
51.
Powers
C.
,
K.
Früh
.
2008
.
Rhesus CMV: an emerging animal model for human CMV.
Med. Microbiol. Immunol. (Berl.)
197
:
109
115
.
52.
Pomplun
N. L.
,
L.
Vosler
,
K. L.
Weisgrau
,
J.
Furlott
,
A. M.
Weiler
,
H. M.
Abdelaal
,
D. T.
Evans
,
D. I.
Watkins
,
T.
Matano
,
P. J.
Skinner
, et al
2021
.
Immunophenotyping of rhesus CMV-specific CD8 T-cell populations.
Cytometry A
99
:
278
288
.
53.
Stoeckius
M.
,
S.
Zheng
,
B.
Houck-Loomis
,
S.
Hao
,
B. Z.
Yeung
,
W. M.
Mauck
III
,
P.
Smibert
,
R.
Satija
.
2018
.
Cell hashing with barcoded antibodies enables multiplexing and doublet detection for single cell genomics.
Genome Biol.
19
:
224
.
54.
Feeney
M. E.
,
Y.
Tang
,
K. A.
Roosevelt
,
A. J.
Leslie
,
K.
McIntosh
,
N.
Karthas
,
B. D.
Walker
,
P. J.
Goulder
.
2004
.
Immune escape precedes breakthrough human immunodeficiency virus type 1 viremia and broadening of the cytotoxic T-lymphocyte response in an HLA-B27-positive long-term-nonprogressing child.
J. Virol.
78
:
8927
8930
.
55.
Pereyra
F.
,
D.
Heckerman
,
J. M.
Carlson
,
C.
Kadie
,
D. Z.
Soghoian
,
D.
Karel
,
A.
Goldenthal
,
O. B.
Davis
,
C. E.
DeZiel
,
T.
Lin
, et al
2014
.
HIV control is mediated in part by CD8+ T-cell targeting of specific epitopes.
J. Virol.
88
:
12937
12948
.
56.
Harari
A.
,
C.
Cellerai
,
F.
Bellutti Enders
,
J.
Köstler
,
L.
Codarri
,
G.
Tapia
,
O.
Boyman
,
E.
Castro
,
S.
Gaudieri
,
I.
James
, et al
2007
.
Skewed association of polyfunctional antigen-specific CD8 T cell populations with HLA-B genotype.
Proc. Natl. Acad. Sci. USA
104
:
16233
16238
.
57.
Goulder
P.
,
C.
Conlon
,
K.
Mclntyre
,
A.
McMichael
.
1996
.
Identification of a novel human leukocyte antigen A26-restricted epitope in a conserved region of Gag.
AIDS
10
:
1441
1443
.
58.
Satoh
M.
,
Y.
Takamiya
,
S.
Oka
,
K.
Tokunaga
,
M.
Takiguchi
.
2005
.
Identification and characterization of HIV-1-specific CD8+ T cell epitopes presented by HLA-A*2601.
Vaccine
23
:
3783
3790
.
59.
Hedrick
S. M.
,
D. I.
Cohen
,
E. A.
Nielsen
,
M. M.
Davis
.
1984
.
Isolation of cDNA clones encoding T cell-specific membrane-associated proteins.
Nature
308
:
149
153
.
60.
Yanagi
Y.
,
Y.
Yoshikai
,
K.
Leggett
,
S. P.
Clark
,
I.
Aleksander
,
T. W.
Mak
.
1984
.
A human T cell-specific cDNA clone encodes a protein having extensive homology to immunoglobulin chains.
Nature
308
:
145
149
.
61.
He
Q.
,
X.
Jiang
,
X.
Zhou
,
J.
Weng
.
2019
.
Targeting cancers through TCR-peptide/MHC interactions.
J. Hematol. Oncol.
12
:
139
.
62.
Blum
J. S.
,
P. A.
Wearsch
,
P.
Cresswell
.
2013
.
Pathways of antigen processing.
Annu. Rev. Immunol.
31
:
443
473
.
63.
Sullivan
L. C.
,
T. H. O.
Nguyen
,
C. M.
Harpur
,
S.
Stankovic
,
A. R.
Kanagarajah
,
M.
Koutsakos
,
P. M.
Saunders
,
Z.
Cai
,
J. A.
Gray
,
J. M. L.
Widjaja
, et al
2021
.
Natural killer cell receptors regulate responses of HLA-E-restricted T cells.
Sci. Immunol.
6
:
eabe9057
.
64.
Huard
B.
,
L.
Karlsson
.
2000
.
KIR expression on self-reactive CD8+ T cells is controlled by T-cell receptor engagement.
Nature
403
:
325
328
.

The authors have no financial conflicts of interest.

Supplementary data