Complement genes encompass a wide array of variants, giving rise to numerous protein isoforms that have often been shown to exhibit clinical significance. Given that these variants have been discovered over a span of 50 y, one challenging consequence is the inconsistency in the terminology used to classify them. This issue is prominently evident in the nomenclature used for complement C6 and C7 variants, for which we observed a great discrepancy between previously published works and variants described in current genome browsers. This report discusses the causes for the discrepancies in C6 and C7 nomenclature and seeks to establish a classification system that would unify existing and future variants. The inconsistency in the methods used to annotate amino acids and the modifications pinpointed in the C6 and C7 primers are some of the factors that contribute greatly to the discrepancy in the nomenclature. Several variants that were classified incorrectly are highlighted in this report, and we showcase first-hand how a unified classification system is important to match previous with current genetic information. Ultimately, we hope that the proposed classification system of nomenclature becomes an incentive for studies on complement variants and their physiological and/or pathological effects.

Complement is an evolutionary ancient component of the immune system that plays a pivotal role in immune surveillance (1). The complement system is composed of an intricate network of ∼60 fluid-phase and membrane-bound proteins involved in host homeostasis and various host defense mechanisms. Three canonical pathways are known to activate complement: the classical pathway, the lectin pathway, and the alternative pathway (2). Whereas the classical and lectin pathways are mainly activated by Ag–Ab immune complexes and mannose-containing sugars, respectively, the alternative pathway is constitutively activated at low grade by a process known as tick-over hydrolysis (3). All three pathways converge at the central point of C3 cleavage, where the C3-cleaved product, C3b, is involved in the formation of the C5 convertase. The C5 convertase initiates the activation of the terminal pathway, characterized by the cleavage of C5 into C5b and C5a. C5b, along with the subsequent addition of the terminal complement proteins C6, C7, and C8 and multiple copies of C9, eventually forms the C5b9 complex, or membrane attack complex (MAC) when bound to membranes (4).

This complex cascade of proteolytic cleavages functions as one of the first lines of defense that is vital against infections by host invading pathogens and bridges between innate and adaptive immunity. Complement responds to infections by opsonizing pathogens, resulting in the recruitment of immune cells that phagocytose the target, ultimately leading to an inflammatory response (5). One of the major features of complement is the MAC-mediated lysis of pathogenic cells, a mechanism that is particularly effective against the Gram-negative bacterium Neisseria meningitides. Consequently, pathogenic variants in complement proteins are associated with several life-threatening diseases. For example, individuals deficient in terminal complement proteins are highly susceptible to recurrent meningococcal infections (6).

Complement deficiencies exist in varying degrees, from complete deficiencies, where complement detection levels are null, to subtotal deficiencies that result in lower complement concentrations with low-grade activity. For instance, C6 subtotal deficiency (C6SD) is characterized by very low, but detectable C6 levels in circulation resulting in low-grade functionality of the C6 protein (7). Remarkably, individuals with C6SD have not been shown to be susceptible to recurrent Neisseria meningitides (8), compared with individuals with complete C6 deficiency (C6Q0), because of the fact that <10% of C6 is adequate to confer substantial complement activity (7, 9).

Polymorphisms in complement proteins have been investigated heavily in the past three decades (10). Although some complement variants occur frequently in the general population, some variants do have the potential to exert pathogenic effects; certain Factor H and C3 variants are associated with severe forms of end-stage renal disease (11). Certain single-nucleotide polymorphisms (SNPs) in complement genes lead to higher susceptibilities to infections, for example, the C5 (rs17611) variant is accompanied by reduced complement levels in circulation (12). Not all reported SNPs pose deleterious phenotypic effects; nevertheless, they can still provide relevant information about the genetic background explaining the variance of a certain trait in a given population.

The advancements in genome sequencing techniques gave rise to a vast amount of data pertaining to genetic variants and their association with phenotypic traits within populations. Genome-wide association studies (GWASs) led to the identification of new disease loci and further shed light on the importance of noncoding DNA regions in a physiological and pathological context (13). More recently, mendelian randomization techniques have been increasingly applied to assess in silico the causal relationship between genes and traits in an unbiased manner (14). The discovery of this massive number of genetic variants is likely to grow in the future, and most of them are yet to be functionally interpreted. For this reason, it is important to report information already available from past functional studies in an efficient way.

One of the challenges we currently face in the complement field is the inconsistency in the nomenclature used in the past to describe the genetic variants of certain genes, like that of complement C6 and C7, compared with the stable accession numbers (rs or RefSNP) assigned to the same variants by reference databases (e.g., Single Nucleotide Polymorphism Database [dbSNP]). In fact, given that most of these variants were discovered in the 1980s and 1990s, there are apparent inconsistencies in the classification system used by different publications and the current genome browsers. For instance, the last reference typing report (15) appears to be completely outdated. Adopting a universal system for describing complement genetic variants in different contexts, such as clinical studies and population-based studies, is of great importance. Indeed, it would allow for a more accessible platform for diagnostics and facilitate the sharing of information.

To this end, the aim of this report is to compile the C6 and C7 variants previously described in complement-deficient patients, identify the allelic variation, and update the nomenclature, harmonizing previous information with the most recent annotations provided by the Human Genome Project (HGP) and those available in genome browsers.

The C6 gene is located on chromosome 5 in the MAC II gene cluster (5p13.1) and is encoded by 18 exons spanning around 72 kbp. C6 is in close proximity with two other terminal complement genes, C7 and C9. C6 and C7 genes are located 160 kbp apart and are found on opposite orientations on the chromosome (16, 17).

C6 is a single-chain glycoprotein with a molecular mass of around 105 kDa. It is composed of 934 aa, where the first 21 aa make up the leader peptide (18). The C6 protein is characterized by a single domain, the MAC perforin (MACPF), and nine cysteine-rich modules (Fig. 1). The MACPF is composed of ∼250 aa, while the cysteine-rich modules range from around 33 to 77 aa each. The modules include three thrombospondins (TSPs), one low-density lipoprotein receptor (LDL), an epidermal growth factor, two short complement regulators (SCR) or complement control proteins, and two factor I modules (FIMs). The protein chain has two N-glycosylation sites, one in MACPF and another within the two FIMs (19).

FIGURE 1.

Molecular structure of C6 and C7 with mapped variants. The protein domains are illustrated for C6 and C7, along with the mapped exons and the intron/exon boundaries. Homologous C6 and C7 domains are aligned, showcasing high homology between the two proteins. The locations of the variants listed in Tables III and V are depicted along the C6 and C7 molecular structures, respectively. The nomenclature of C6 and C7 variants shown in this diagram are in accordance with the updated numbering system.

FIGURE 1.

Molecular structure of C6 and C7 with mapped variants. The protein domains are illustrated for C6 and C7, along with the mapped exons and the intron/exon boundaries. Homologous C6 and C7 domains are aligned, showcasing high homology between the two proteins. The locations of the variants listed in Tables III and V are depicted along the C6 and C7 molecular structures, respectively. The nomenclature of C6 and C7 variants shown in this diagram are in accordance with the updated numbering system.

Close modal

C6 is one of the essential terminal complement proteins required for the formation of the MAC. C6 binds to C5b to form a stable complex known as C5b6. Aleshin et al. (20) elegantly describe four interfaces at which C5b and C6 engage to form a stable conformation. The main C6 modules that participate within the interacting surface areas with C5b are: (1) TSP2 and LDL, (2) TSP3 and the TSP3-SCR1 linker, (3) SCR1, and (4) the FIMs. The binding of the FIMs to C5b is an initial, reversible interaction that acts as a platform for the rest of the C6 modules to bind irreversibly to C5b. The formation of C5b6 prompts the sequential addition of C7, C8, and C9 (20).

The main site for C6 synthesis is the liver, with earlier studies reporting the ability of several cells to produce C6, including endothelial cells, monocytes, fibroblasts, glial cells, and neurons (2126). As a result of the advancement in RNA sequencing analysis, we can presently observe the expression of C6 in various other types of tissue. For instance, C6 can be seen highly expressed in cardiac tissue and skeletal muscle tissue (27).

The C7 gene is part of the MAC II gene cluster located in chromosome 5 (5p13.1). Similar to C6, it is encoded by 18 exons and is also ∼80 kbp long. The C7 and C6 genes are a product of gene duplication arising from a common ancestral gene, highlighting the tight linkage of these two genes on the chromosome. In this case, the close proximity between the genes reflects high homology between the C7 and C6 protein domains (19). Nevertheless, C7 possesses distinct motifs and binding patterns, and plays a relatively different role in the terminal pathway.

C7 is a single-chain glycoprotein with a molecular mass of around 94 kDa. It is composed of 843 aa, where the first 22 aa make up the leader peptide. Similar to C6, C7 is characterized by a single MACPF domain, with eight cysteine-rich modules (Fig. 1). The MACPF is composed of ∼240 aa, while the cysteine-rich modules range from 34 to 75 aa each. The modules include two TSPs, one LDL, one epidermal growth factor, two SCRs or complement control proteins, and two FIMs. C7 has two N-glycosylation sites, one in the MACPF domain and one in FIM1 (28, 29).

On the formation of the C5b6 complex, C7 consecutively binds to form the C5b7 complex. C7 binding to C5b6 enables the complex to transition to an amphiphilic structure that tethers to outer layers of phospholipid membranes (20). C7 binds to C5b6 mainly via its C-terminal domains. Once the SCR domains of C7 line the periphery of the C5b MG domains, they facilitate the direct binding of the C7 FIMs to the C345C domain of C5b. The FIM domains of C6 and C7 exhibit competitive binding to the C5b domain, C345C. However, because the binding of C6 FIMs to C345C is reversible, C7 FIMs displace the C6 FIM domains to form an amphiphilic C5b67 complex. C8 and multiple copies of C9 are sequentially added to form a membrane-bound MAC (20, 30).

The liver is not considered the main site for C7 synthesis, a key factor that distinguishes C7 from other complement proteins (31). The majority of C7 is produced in local regions and surfaces such as endothelial cells, Kupffer cells, granulocytes, fibroblasts, neurons, and glial cells (23, 25, 26). The formation of MAC on surfaces may be contingent on the presence of C7 in that specific region. Thus, C7 may act as a limiting factor for the local assembly of MAC. This unique property renders C7 not only as a crucial component of the MAC but also as a potential regulator of complement (32).

Previously described C6 and C7 variants were obtained from published works that identified and characterized variants in individuals and families with complement deficiencies. For each published variant, we noted the cDNA position, the amino acid position, the reference and alternate alleles, the effect of the variant on the final protein product, and the frequency of said variant as reported by each article. We sought to compile a comprehensive list of published C6/C7 variants; thus, we searched for articles that focused on characterizing complement variants dating back from 1970 up until 2021. The most frequently used search engines for literature searches were PubMed and Google Scholar.

The originally published nucleotide sequences of C6 and C7 primers and amplified exons (33, 34) were revised according to the most recent sequence references reported by the genetic sequence database, GenBank, for C6 (NG_011582.1) (35) and C7 (NG_011692.1) (36). A sequence alignment was performed such that deviations discovered in the original C6 and C7 sequences were amended based on the GenBank reference sequences. Consequently, the exon numbers of original C6 and C7 amplified exons were further corrected to match the numbers reported by GenBank.

The nomenclature of every C6 and C7 variant acquired from the literature search was updated manually based on the earlier-described revision of C6 and C7 primers and amplified exons. To corroborate our proposed nomenclature of these variants, we assessed the genomic and RefSNP mapping information provided by the dbSNP (build 155) for each variant. We further contacted the helpdesk of the Ensembl genome browsers by e-mail for a variant that was reported with the incorrect or outdated nomenclature.

The discrepancy we currently observe in C6 and C7 nomenclature is mainly due to the inconsistent method of numbering exons and amino acids, whereby old variant names no longer match the assigned stable accession numbers (rs or RefSNP) currently found in public genetic variation databases, such as dbSNP, ClinVar, and gnomAD, or in genome browsers (e.g., University of California Santa Cruz genome browser, Ensembl). This is a consequence of the independent annotation of variants by different researchers before the initiation of the HGP. Indeed, the HGP revolutionized the research paradigm in genetics, leading to the large-scale discovery and annotation of a massive number of variants in a relatively short period. However, the annotation system deployed by the HGP slightly differs from that used by researchers in the early 1990s, leading to the inconsistency we currently observe in the nomenclature of variants.

Without a cohesive numbering system to refer to, these aspects could cumulatively result in the erroneous classification of C6 and C7 variants in gene databases. We are also challenged by publications and databases that use different nomenclatures to describe the same variants. The improper classification of these polymorphisms can result in certain C6 and C7 polymorphisms being unaccounted for in GWASs. Furthermore, studies that investigate gene alternative splicing could render a potentially significant gene variant as an artifact if the exon reading frame was misinterpreted. An updated classification system not only unifies the nomenclature of existing variants but also facilitates the identification of novel ones. This section discusses the factors that contribute to variations in the numbering system and proposes the synchronization of past and current nomenclature. The results can be used as a reference for future studies on complement C6 and C7.

Studies conducted by DiScipio et al. (28) and DiScipio and Hugli (18), which described the molecular architecture of the C6 and C7 gene and polypeptide chain, served as the basis for subsequent publications that sought to characterize variants associated with these two terminal complement proteins. Numerous studies used the numbering system proposed by DiScipio and colleagues (18, 28) to pinpoint the location of C6 and C7 variants of interest. However, the annotations described in the articles by DiScipio and colleagues differ slightly from those provided by current genome browsers. Consequently, some cases of C6 and C7 variants are submitted to the genome browsers using the outdated nomenclature system, making it difficult to search for specific variants of interest.

The discrepancy observed between the present numbering system and the one proposed by DiScipio et al. (28) and DiScipio and Hugli (18) is associated with two main factors: the assigned location of the first amino acid residue and the method by which coding exons are numbered.

The assigned numbers for C6 and C7 amino acid sequences have been modified in current gene databases, compared with the numbering system used by DiScipio et al. (28) and DiScipio and Hugli (18). Although the old nomenclature system distinguished the leader peptide from the mature protein, presently, the leader peptide is recognized as part of the mature protein. The C6 amino acid sequence illustrated by DiScipio and Hugli (18) excludes the leader peptide when numbering the mature protein. Given that the C6 leader peptide is 21 aa long, DiScipio and Hugli (18) designated it with the numbers −21 through 0, while the mature protein was numbered 1 through 913. In contrast, the numbering of the C6 amino acid sequence in gene databases begins at the first residue of the leader peptide, where the amino acid sequence is reported to be 934 aa long. Similarly, the leader peptide was not considered part of the C7 amino acid sequence described by DiScipio et al. (28). The C7 leader peptide was designated with the numbers −22 through 0, while the mature protein was numbered 1 through 821. In the present gene database, the leader peptide is considered to be part of the mature protein, and the C7 aa sequence is reported to be 843 aa long.

The aforementioned modification in numbering of amino acid residues consequently affected the method by which C6 and C7 exons are numbered. Although the primers formerly used still amplify the same C6 and C7 exons, the exon numbering in current genome browsers has been shifted by one unit (i.e., exon 1 is now exon 2 and so on) because the leader peptide is now considered part of the mature protein.

The previously described C6 primers (33) overlap with the current DNA sequence found in GenBank (NG_011582.1), with minor nucleotide differences; the amplified exon sequences are shifted by one unit. Fernie et al. (34) also described the primers used to sequence the C7 exons, which can presently be found inthe GenBank C7 gene reference (NG_011692.1). We have similarly observed a few minor sequence changes in primers. The revisions made to the C6 and C7 primer sequences, along with the corresponding amplified exons, are summarized in Tables I and II.

Table I.

Primers and products of PCR amplification of C6 exons

Exon No. (33)Updated Exon No.FWD Primer (5′–3′)REV Primer (5′–3′)Revised FWD and REV Primer Sequences (5′–3′)Sequence of Amplified Exon (5′–3′)
N/A N/A N/A Not captured by any primer AGGCTTCTGGGATATGACAGCATTGCCTTGTGTTAGCTAGCAATAAGAAAAG AAGCTTTGTTTGGATTAACATATATACCCTCTTCATTCTGCATACCTATT TTTTCCCCAATAATTTGCAGCTTAGGTCCGAGGACACCACAAACTCTGCT TAAAG 
CTGACTCAGGATGA CTTGTGA TTCATCCTTGAGTCCT TCCAG  GGCCTGGAGGCTCTCAAGGCATGGCCAGACGCTCTGTCTTGTACTTCATCCT GCTGAATGCTCTGATCAACAAGGGCCAAGCCTGCTTCTGTGATCACTATG CATGGACTCAGTGGACCAGCTGCTCAAAAACTTGCAATTCTGGAACCCAG AGCAGACACAG 
TATGGAGCAGGATATA TGGTG TCAGAGCCCTCTATTG TGATT  ACAAATAGTAGTAGATAAGTACTACCAGGAAAACTTTTGTGAACAGATTTGC AGCAAGCAGGAGACTAGAGAATGTAACTGGCAAAGATGCCCCATCAACTG CCTCCTGGGAGATTTTGGACCATGGTCAGACTGTGACCCTTGTATTGAAA AACAG 
TTGACCCTGCCTC AGAGTTAT AGTGGGGACTGAACA TTTCAC  TCTAAAGTTAGATCTGTCTTGCGTCCCAGTCAGTTTGGGGGACAGCCATGCA CTGCGCCTCTGGTAGCCTTTCAACCATGCATTCCATCTAAGCTCTGCAAA ATTGAAGAGGCTGACTGCAAGAATAAATTTCGCTGTGACAGTG 
AGACTTGCCTTCAA CTTTACC TTGTTCTGATACC TGTTCTCC  GCCGCTGCATTGCCAGAAAGTTAGAATGCAATGGAGAAAATGACTGTGGAGA CAATTCAGATGAAAGGGACTGTGGGAGGACAAAGGCAGTATGCACACGGA AGTATAATCCCATCCCTAGTGTACAGTTGATGGGCAATGG 
GTTCTACATCTGTT GAATTCC TAGCTTATAATCACT GACGGT  GTTTCATTTTCTGGCAGGAGAGCCCAGAGGAGAAGTCCTTGATAACTCTTTC ACTGGAGGAATATGTAAAACTGTCAAAAGCAGTAGGACAAGTAATCCATA CCGTGTTCCGGCCAATCTGGAAAATGTCGGCTTTGAG 
AGATATCCACAAG TCGCTCCC GTATTAGAAGTC ATACTTGGTAC AGATATCCACAAGTCGCTCCA
A replaces C in FWD
GTATTAGAAGTCATAC-TGGTAC
One T is missing in REV 
GTACAAACTGCAGAAGATGACTTGAAAACAGATTTCTACAAGGATTTAACTT CTCTTGGACACAATGAAAATCAACAAGGCTCATTCTCAAGTCAGGGGGGG AGCTCTTTCAGTGTACCAATTTTTTATTCCTCAAAGAGAAGTGAAAATAT CAACCATAATTCTGCCTTCAAACAAGCCATTCAAGCCTCTCACAAAAAG 
ATGCTAGGTAC TTCAACC and GAACATGCAATAGA GAGTGA (M7F) GTATTGCATGCTAT CATACCAG and GCAGGATCTAAAT AAAGTCA (M7R) (flanking) ATGCTAGGTACTTCAAAC
A replaces C in FWD 
GATTCTAGTTTTATTAGGATCCATAAAGTGATGAAAGTCTTAAACTTCACA ACGAAAGCTAAAGATCTGCACCTTTCTGATGTCTTTTTGAAAGCACTTA ACCATCTGCCTCTAGAATACAACTCTGCTTTGTACAGCCGAATATTCGA TGACTTTGGGACTCATTACTTCACCTCTGGCTCCCTGGGAGGCGTGTAT GACCTTCTCTATCAGTTTAGCAGTGAGGAACTAAAGAACTCAG 
GCACCATGTTCC TCTTTTGAAT ATGGTCTGTAAATG ACAGCCA and CACTGGATAAGCT GCTAAGA (heminested) GCACCATGTTCCTCTTT-GAAT
One T is missing in FWD 
GTTTAACCGAGGAAGAAGCCAAACACTGTGTCAGGATTGAAACAAAGAAAC GCGTTTTATTTGCTAAGAAAACAAAAGTGGAACATAGGTGCACCACCAA CAAGCTGTCAGAGAAACATGAAG 
10 TTCTGTACAA ATAGGTTT TTAGATCTCTT ACCTGGA  GTTCATTTATACAGGGAGCAGAGAAATCCATATCCCTGATTCGAGGTGGAA GGAGTGAATATGGAGCAGCTTTGGCATGGGAGAAAGGGAGCTCTGGTCT GGAGGAGAAGACATTTTCTGAGTGGTTAGAATCAGTGAAGGAAAATCCT GCTGTGATTGACTTTGAG 
10 11 TCAGAGAACTG GGCAGTAATG GTACAAGGTGG AGGTTGCTAA  CTTGCCCCCATCGTGGACTTGGTAAGAAACATCCCCTGTGCAGTGACAAAA CGGAACAACCTCAGGAAAGCTTTGCAAGAGTATGCAGCCAAGTTCGATC CTTGCCAGTGTGCTCCATGCCCTAATAATGGCCGACCCACCCTCTCAGG GACTGAATGTCTGTGTGTGTGTCAGAGTGGCACCTATGGTGAGAACTGT GAGAAACAGTCTCCAGATTATAAATCCA 
11 12 TTCAGCTGCACCA TGATCCAT TCTGTGTTGGCATAG GTAAAGT  ATGCAGTAGACGGACAGTGGGGTTGTTGGTCTTCCTGGAGTACCTGTGATGC TACTTATAAGAGATCGAGAACCCGAGAATGCAATAATCCTGCCCCCCAAC GAGGAGGGAAACGCTGTGAGGGGGAGAAGCGACAAGAGGAAGACTGCACA TTTTCAATCATGGAAAACAA 
12 13 GTATGCAAT GTGTACACATGT ACCAAAAGTGA GGTTTAGGAT  TGGACAACCATGTATCAATGATGATGAAGAAATGAAAGAGGTCGATCTTCCT GAGATAGAAGCAGATTCCGGGTGTCCTCAGCCAGTTCCTCCAGAAAATGG ATTTATCCGG 
13 14 GCCTTAAAGAGTTTA GAGAGT ATATTGGGCACA TTCATTCTG AGACTAAAGAGTTTAGAGAGT
AGAC replaces GCCT in FWD 
AATGAAAAGCAACTATACTTGGTTGGAGAAGATGTTGAAATTTCATGCCTTA CTGGCTTTGAAACTGTTGGATACCAGTACTTCAGATGCTTACCAGACGGG ACCTGGAGACAAGGGGATGTGGAATGCCAAC 
14 15 ATCACCTCTTTGG TTGCACAA TGGCTATAGAGGCT ATACTAC  GGACGGAGTGCATCAAGCCAGTTGTGCAGGAAGTCCTGACAATTACACCATT TCAGAGATTGTATAGAATTGGTGAATCCATTGAGCTAACTTGCCCCAAAG GCTTTGTTGTTGCTGGGCCATCAAGGTACACATGCCAGGGGAATTCCTGG ACACCACCCATTTCAAACTCTCTCACCTGTGAAAAAG 
15 16 CCTTTACCACTG CCTCTTCTCTGA TTAAACAGGGAA CTGGGCTGAGAG  ATACTCTAACAAAATTAAAAGGCCATTGTCAGCTGGGACAGAAACAATCAGG ATCTGAATGCATTTGTATGTCTCCAGAAGAAGACTGTAG 
16 17 AGTGAACACACTA CATTGGCT GTACTAGCTGAG ATGAAGGTT  CCATCATTCAGAAGATCTCTGTGTGTTTGACACAGACTCCAACGATTACTTT ACTTCACCCGCTTGTAAGTTTTTGGCTGAGAAATGTTTAAATAATCAGCA ACTCCATTTTCTACATATTGGTTCCTGCCAAGACGGCCGCCAGTTAGAAT GGGGTCTTGAAAGGACAAGACTTTCATCCAACAGCACAAAGAAAGAATCC TGTGGCTATGACACCTGCTATGACTGGGAAAAATGTTCAG 
17 18 TAGATAAAGCCAATCCCTAATGT TGTCAGTAAC TTTGAGCA TAGATAAAGCCAAACCCTAATGT
A replaces T in FWD 
CCTCCACTTCCAAATGTGTCTGCCTATTGCCCCCACAGTGCTTCAAGGGTGG AAACCAACTCTACTGTGTCAAAATGGGATCATCAACAAGTGAGAAAACAT TGAACATCTGTGAAGTGGGAACTATAAGATGTGCAAACAGGAAGATGGAA ATACTGCATCCTGGAAAGTGTTTGGCCTAG 
Exon No. (33)Updated Exon No.FWD Primer (5′–3′)REV Primer (5′–3′)Revised FWD and REV Primer Sequences (5′–3′)Sequence of Amplified Exon (5′–3′)
N/A N/A N/A Not captured by any primer AGGCTTCTGGGATATGACAGCATTGCCTTGTGTTAGCTAGCAATAAGAAAAG AAGCTTTGTTTGGATTAACATATATACCCTCTTCATTCTGCATACCTATT TTTTCCCCAATAATTTGCAGCTTAGGTCCGAGGACACCACAAACTCTGCT TAAAG 
CTGACTCAGGATGA CTTGTGA TTCATCCTTGAGTCCT TCCAG  GGCCTGGAGGCTCTCAAGGCATGGCCAGACGCTCTGTCTTGTACTTCATCCT GCTGAATGCTCTGATCAACAAGGGCCAAGCCTGCTTCTGTGATCACTATG CATGGACTCAGTGGACCAGCTGCTCAAAAACTTGCAATTCTGGAACCCAG AGCAGACACAG 
TATGGAGCAGGATATA TGGTG TCAGAGCCCTCTATTG TGATT  ACAAATAGTAGTAGATAAGTACTACCAGGAAAACTTTTGTGAACAGATTTGC AGCAAGCAGGAGACTAGAGAATGTAACTGGCAAAGATGCCCCATCAACTG CCTCCTGGGAGATTTTGGACCATGGTCAGACTGTGACCCTTGTATTGAAA AACAG 
TTGACCCTGCCTC AGAGTTAT AGTGGGGACTGAACA TTTCAC  TCTAAAGTTAGATCTGTCTTGCGTCCCAGTCAGTTTGGGGGACAGCCATGCA CTGCGCCTCTGGTAGCCTTTCAACCATGCATTCCATCTAAGCTCTGCAAA ATTGAAGAGGCTGACTGCAAGAATAAATTTCGCTGTGACAGTG 
AGACTTGCCTTCAA CTTTACC TTGTTCTGATACC TGTTCTCC  GCCGCTGCATTGCCAGAAAGTTAGAATGCAATGGAGAAAATGACTGTGGAGA CAATTCAGATGAAAGGGACTGTGGGAGGACAAAGGCAGTATGCACACGGA AGTATAATCCCATCCCTAGTGTACAGTTGATGGGCAATGG 
GTTCTACATCTGTT GAATTCC TAGCTTATAATCACT GACGGT  GTTTCATTTTCTGGCAGGAGAGCCCAGAGGAGAAGTCCTTGATAACTCTTTC ACTGGAGGAATATGTAAAACTGTCAAAAGCAGTAGGACAAGTAATCCATA CCGTGTTCCGGCCAATCTGGAAAATGTCGGCTTTGAG 
AGATATCCACAAG TCGCTCCC GTATTAGAAGTC ATACTTGGTAC AGATATCCACAAGTCGCTCCA
A replaces C in FWD
GTATTAGAAGTCATAC-TGGTAC
One T is missing in REV 
GTACAAACTGCAGAAGATGACTTGAAAACAGATTTCTACAAGGATTTAACTT CTCTTGGACACAATGAAAATCAACAAGGCTCATTCTCAAGTCAGGGGGGG AGCTCTTTCAGTGTACCAATTTTTTATTCCTCAAAGAGAAGTGAAAATAT CAACCATAATTCTGCCTTCAAACAAGCCATTCAAGCCTCTCACAAAAAG 
ATGCTAGGTAC TTCAACC and GAACATGCAATAGA GAGTGA (M7F) GTATTGCATGCTAT CATACCAG and GCAGGATCTAAAT AAAGTCA (M7R) (flanking) ATGCTAGGTACTTCAAAC
A replaces C in FWD 
GATTCTAGTTTTATTAGGATCCATAAAGTGATGAAAGTCTTAAACTTCACA ACGAAAGCTAAAGATCTGCACCTTTCTGATGTCTTTTTGAAAGCACTTA ACCATCTGCCTCTAGAATACAACTCTGCTTTGTACAGCCGAATATTCGA TGACTTTGGGACTCATTACTTCACCTCTGGCTCCCTGGGAGGCGTGTAT GACCTTCTCTATCAGTTTAGCAGTGAGGAACTAAAGAACTCAG 
GCACCATGTTCC TCTTTTGAAT ATGGTCTGTAAATG ACAGCCA and CACTGGATAAGCT GCTAAGA (heminested) GCACCATGTTCCTCTTT-GAAT
One T is missing in FWD 
GTTTAACCGAGGAAGAAGCCAAACACTGTGTCAGGATTGAAACAAAGAAAC GCGTTTTATTTGCTAAGAAAACAAAAGTGGAACATAGGTGCACCACCAA CAAGCTGTCAGAGAAACATGAAG 
10 TTCTGTACAA ATAGGTTT TTAGATCTCTT ACCTGGA  GTTCATTTATACAGGGAGCAGAGAAATCCATATCCCTGATTCGAGGTGGAA GGAGTGAATATGGAGCAGCTTTGGCATGGGAGAAAGGGAGCTCTGGTCT GGAGGAGAAGACATTTTCTGAGTGGTTAGAATCAGTGAAGGAAAATCCT GCTGTGATTGACTTTGAG 
10 11 TCAGAGAACTG GGCAGTAATG GTACAAGGTGG AGGTTGCTAA  CTTGCCCCCATCGTGGACTTGGTAAGAAACATCCCCTGTGCAGTGACAAAA CGGAACAACCTCAGGAAAGCTTTGCAAGAGTATGCAGCCAAGTTCGATC CTTGCCAGTGTGCTCCATGCCCTAATAATGGCCGACCCACCCTCTCAGG GACTGAATGTCTGTGTGTGTGTCAGAGTGGCACCTATGGTGAGAACTGT GAGAAACAGTCTCCAGATTATAAATCCA 
11 12 TTCAGCTGCACCA TGATCCAT TCTGTGTTGGCATAG GTAAAGT  ATGCAGTAGACGGACAGTGGGGTTGTTGGTCTTCCTGGAGTACCTGTGATGC TACTTATAAGAGATCGAGAACCCGAGAATGCAATAATCCTGCCCCCCAAC GAGGAGGGAAACGCTGTGAGGGGGAGAAGCGACAAGAGGAAGACTGCACA TTTTCAATCATGGAAAACAA 
12 13 GTATGCAAT GTGTACACATGT ACCAAAAGTGA GGTTTAGGAT  TGGACAACCATGTATCAATGATGATGAAGAAATGAAAGAGGTCGATCTTCCT GAGATAGAAGCAGATTCCGGGTGTCCTCAGCCAGTTCCTCCAGAAAATGG ATTTATCCGG 
13 14 GCCTTAAAGAGTTTA GAGAGT ATATTGGGCACA TTCATTCTG AGACTAAAGAGTTTAGAGAGT
AGAC replaces GCCT in FWD 
AATGAAAAGCAACTATACTTGGTTGGAGAAGATGTTGAAATTTCATGCCTTA CTGGCTTTGAAACTGTTGGATACCAGTACTTCAGATGCTTACCAGACGGG ACCTGGAGACAAGGGGATGTGGAATGCCAAC 
14 15 ATCACCTCTTTGG TTGCACAA TGGCTATAGAGGCT ATACTAC  GGACGGAGTGCATCAAGCCAGTTGTGCAGGAAGTCCTGACAATTACACCATT TCAGAGATTGTATAGAATTGGTGAATCCATTGAGCTAACTTGCCCCAAAG GCTTTGTTGTTGCTGGGCCATCAAGGTACACATGCCAGGGGAATTCCTGG ACACCACCCATTTCAAACTCTCTCACCTGTGAAAAAG 
15 16 CCTTTACCACTG CCTCTTCTCTGA TTAAACAGGGAA CTGGGCTGAGAG  ATACTCTAACAAAATTAAAAGGCCATTGTCAGCTGGGACAGAAACAATCAGG ATCTGAATGCATTTGTATGTCTCCAGAAGAAGACTGTAG 
16 17 AGTGAACACACTA CATTGGCT GTACTAGCTGAG ATGAAGGTT  CCATCATTCAGAAGATCTCTGTGTGTTTGACACAGACTCCAACGATTACTTT ACTTCACCCGCTTGTAAGTTTTTGGCTGAGAAATGTTTAAATAATCAGCA ACTCCATTTTCTACATATTGGTTCCTGCCAAGACGGCCGCCAGTTAGAAT GGGGTCTTGAAAGGACAAGACTTTCATCCAACAGCACAAAGAAAGAATCC TGTGGCTATGACACCTGCTATGACTGGGAAAAATGTTCAG 
17 18 TAGATAAAGCCAATCCCTAATGT TGTCAGTAAC TTTGAGCA TAGATAAAGCCAAACCCTAATGT
A replaces T in FWD 
CCTCCACTTCCAAATGTGTCTGCCTATTGCCCCCACAGTGCTTCAAGGGTGG AAACCAACTCTACTGTGTCAAAATGGGATCATCAACAAGTGAGAAAACAT TGAACATCTGTGAAGTGGGAACTATAAGATGTGCAAACAGGAAGATGGAA ATACTGCATCCTGGAAAGTGTTTGGCCTAG 

The exon numbers and primers used by Hobart et al. (33) are shown, along with the reverse complement primers. The updated exon numbers are annotated according to the numbering criteria provided by current gene databases. The primers were revised and corrected according to the primers provided for the current C6 sequence reference (NG_011582.1), together with the amplified sequences of C6 exons. The first run of nucleotides (bold, underlined) is not incorporated within the amplified exons. Bold indicates nucleotides affected by changes; dash represents deleted nucleotide position.

FWD, forward; N/A; not available; REV, reverse.

Table II.

Primers and products of PCR amplification of C7 exons

Exon No. (59)Updated Exon No.Forward Primer (5′–3′)Reverse Primer (5′–3′)Revised FWD and REV Primer Sequences (5′–3′)Sequence of Amplified Exon (5′–3′)
N/A N/A N/A Not captured by any primer AGGGAGAGGCAGAGAGGCAGGCAGCCTGCTGGGCTCTTCCT GCTGTTGAAAACTTACCCGGCCCTTACAGAGGAAATCTT CCTCCTCTCTTCTGCCCTGAATGTTTTCCCAAACATGAAG 
TCACTTTGTAC CCCATAAATT TGAATCTGTGTAT CCCTCCAAC  GTGATAAGCTTATTCATTTTGGTGGGATTTATAGGAGAGTT CCAAAGTTTTTCAAG 
ATTCTTTGTGT TCCCTTGCG TTGGCATGGC CAAAATGG  TGCCTCCTCTCCAGTCAACTGCCAGTGGGACTTCTATGCCC CTTGGTCAGAATGCAATGGCTGTACCAAGACTCAG 
ACCAGAACAAT TTTCCAGACG TTCCATAGGCT CAGCATGCA  ACTCGCAGGCGGTCAGTTGCTGTGTATGGGCAGTATGGAGG CCAGCCTTGTGTTGGAAATGCTTTTGAAACACAGTCCT GTGAACCTACAAGAGGATGTCCAACAGAGGAGGGATGT GGAGAGCGTTTCAGGTGCTTTTCAG 
GGTCCTGGGTA GTG-TTCTCC GGCAGCCTCCT GAGTACATC GGTCCTGGGTA GTGTTTCTCC
One T is added in FWD 
GTCAGTGCATCAGCAAATCATTGGTTTGCAATGGGGATT CTGACTGTGATGAAGACAGTGCTGATGAAGACAGATGT GAGGACTCAGAAAGGAGACCTTCCTGTGATATCGATAA ACCTCCTCCTAACATAGAACTTACTGGAAATGG 
GGGGAAGCTGGA TAATGTATGG ATGGCCTAATGT GTGGTCAATT  TTACAATGAACTCACTGGCCAGTTTAGGAACAGAGTCATC AATACCAAAAGTTTTGGTGGTCAATGTAGAAAGGTGTT TAGTGGGGATGGAAAAGATTTCTACAGGCTGAGTGGAA ATGTCCTGTCCTATACATTCCAG 
TGCATTTGTGCCAAT GAAGAGC ATTTATACTGGCC AGGCACA TGC-TTTGTGCCA ATGAAGAGC
A is missing in FWD 
GTGAAAATAAATAATGATTTTAATTATGAATTTTACAATA GTACTTGGTCTTATGTAAAACATACGTCGACAGAACAC ACATCATCTAGTCGGAAGCGCTCCTTTTTTAGATCTTC ATCATCTTCTTCACGCAGTTATACTTCACATACCAATG AAATCCATAAAGGAAAG 
TTGGTTGATTGGA GATGAGAGC AGGCATTTCTGGGA TTTTAATGGG  AGTTACCAACTGCTGGTTGTTGAGAACACTGTTGAAGTGG CTCAGTTCATTAATAACAATCCAGAATTTTTACAACTT GCTGAGCCATTCTGGAAGGAGCTTTCCCACCTCCCCTC TCTGTATGACTACAGTGCCTACCGAAGATTAATCGACC AGTACGGGACACATTATCTGCAATCTGGGTCGTTAGGA GGAGAATACAGAGTTCTATTTTATGTGGACTCAGAAAA ATTAAAACAAAATG 
TCACTCTTGATT AGATGGCC GGTAAACTTGTG TCATGGGG  ATTTTAATTCAGTCGAAGAAAAGAAATGTAAATCCTCAGG TTGGCATTTTGTCGTTAAATTTTCAAGTCATGGATGCA AGGAACTGGAAAACGCTTTAAAAGCTGCTTCAG 
10 GCTCTGCCTATTCA TCCCTCCC AATTAGCATTTTCC GTATCCCAAT  GAACCCAGAACAATGTATTGCGAGGAGAACCGTTCATCAG AGGGGGAGGTGCAGGCTTCATATCTGGCCTTAGTTACC TAGAGCTGGACAATCCTGCTGGAAACAAAAGGCGATAT TCTGCCTGGGCAGAATCTGTGACTAATCTTCCTCAAGT CATAAAACAAAAG 
10 11 TAACAAACTTACCCGTGGCT CCCTGTTTCTC TGCTCCTTG TAACAAACTTGCCCGTGGCT
G replaces A in FWD 
CTGACACCTTTATATGAGCTGGTAAAGGAAGTACCTTGTG CCTCTGTGAAAAAACTATACCTGAAATGGGCTCTTGAA GAGTATCTGGATGAATTTGACCCCTGTCATTGCCGGCC TTGTCAAAATGGTGGTTTGGCTACTGTTGAGGGGACCC ATTGTCTGTGCCATTGCAAACCGTACACATTTGGTGCG GCGTGTGAGCAAGGAGTCCTCGTAGGGAATCAAGCAG 
11 12 TTGTTAGCAGG AAGCATAGC GGCTATTTTTA CCAGGGACT  GAGGGGTTGATGGAGGTTGGAGTTGCTGGTCCTCTTGGAG CCCCTGTGTCCAAGGGAAGAAAACAAGAAGCCGTGAAT GCAATAACCCACCTCCCAGTGGGGGTGGGAGATCCTGC GTTGGAGAAACGACAGAAAGCACACAATGCGAAGATG AGGAGCTGGAGCACTTGAG 
12 13 GATACAAAGGAG AAATCCAACG TCTTCCTCCA TGGTGAAG  GTTGCTTGAACCACATTGCTTTCCTTTGTCTTTGGTTCCA ACAGAATTCTGTCCATCACCTCCTGCCTTGAAAGATGGA TTTGTTCAA 
13 14 GCTTGCCTGATG ATTATGATTT GAATAAGCCC TCCGCCT  GATGAAGGTACAATGTTTCCTGTGGGGAAAAATGTAGTGT ACACTTGCAATGAAGGATACTCTCTTATTGGAAACCCA GTGGCCAGATGTGGAGAAGATTTACGGTGGCTTGTTGG GGAAATGCATTGTCAGA 
14 15 CGTCTTCCTCC TTGTCCTCT ACCCAGGCAAG TGAGAGTCC  AAATTGCCTGTGTTCTACCTGTACTGATGGATGGCATACA GAGTCACCCCCAAAAACCTTTCTACACAGTTGGTGAGA AGGTGACTGTTTCCTGTTCAGGTGGCATGTCCTTAGAA GGTCCTTCAGCATTTCTCTGTGGCTCCAGCCTTAAGTG GAGTCCTGAGATGAAGAATGCCCGCTGTGTACAAAAAG 
15 16 AAGAGGCTTTTC TCCTAACG TGTTGGATGGA AGGTGTAGC  AAAATCCGTTAACACAGGCAGTGCCTAAATGTCAGCGCTG GGAGAAACTGCAGAATTCAAGATGTGTTTGTAAAATGC CCTACGAATGTGG 
16 17 AACATCTGGGG GCACTAAGC ATAAGAATGCTAAA GTCACAGTAC  ACCTTCCTTGGATGTATGTGCTCAAGATGAGAGAAGCAA AAGGATACTGCCTCTGACAGTTTGCAAGATGCATGTT CTCCACTGTCAGGGTAGAAATTACACCCTTACTGGTA GGGACAGCTGTACTCTGCCTGCCTCAGCTGAGAAAGC TTGTGGTGCCTGCCCACTGTGGGGAAAATGTGATG 
17 18 CCCAATTTCC TGGTCCTA TTACCTTCTC TGGGCCTT  CTGAGAGCAGCAAATGTGTCTGCCGAGAAGCATCGG AGTGCGAGGAAGAAGGGTTTAGCATTTGTGTGGAAGT GAACGGCAAGGAGCAGACGATGTCTGAGTGTGAGGCG GGCGCTCTGAGATGCAGAGGGCAGAGCATCTCTGTCAC CAGCATAAGGCCTTGTGCTGCGGAAACCCAGTAG 
Exon No. (59)Updated Exon No.Forward Primer (5′–3′)Reverse Primer (5′–3′)Revised FWD and REV Primer Sequences (5′–3′)Sequence of Amplified Exon (5′–3′)
N/A N/A N/A Not captured by any primer AGGGAGAGGCAGAGAGGCAGGCAGCCTGCTGGGCTCTTCCT GCTGTTGAAAACTTACCCGGCCCTTACAGAGGAAATCTT CCTCCTCTCTTCTGCCCTGAATGTTTTCCCAAACATGAAG 
TCACTTTGTAC CCCATAAATT TGAATCTGTGTAT CCCTCCAAC  GTGATAAGCTTATTCATTTTGGTGGGATTTATAGGAGAGTT CCAAAGTTTTTCAAG 
ATTCTTTGTGT TCCCTTGCG TTGGCATGGC CAAAATGG  TGCCTCCTCTCCAGTCAACTGCCAGTGGGACTTCTATGCCC CTTGGTCAGAATGCAATGGCTGTACCAAGACTCAG 
ACCAGAACAAT TTTCCAGACG TTCCATAGGCT CAGCATGCA  ACTCGCAGGCGGTCAGTTGCTGTGTATGGGCAGTATGGAGG CCAGCCTTGTGTTGGAAATGCTTTTGAAACACAGTCCT GTGAACCTACAAGAGGATGTCCAACAGAGGAGGGATGT GGAGAGCGTTTCAGGTGCTTTTCAG 
GGTCCTGGGTA GTG-TTCTCC GGCAGCCTCCT GAGTACATC GGTCCTGGGTA GTGTTTCTCC
One T is added in FWD 
GTCAGTGCATCAGCAAATCATTGGTTTGCAATGGGGATT CTGACTGTGATGAAGACAGTGCTGATGAAGACAGATGT GAGGACTCAGAAAGGAGACCTTCCTGTGATATCGATAA ACCTCCTCCTAACATAGAACTTACTGGAAATGG 
GGGGAAGCTGGA TAATGTATGG ATGGCCTAATGT GTGGTCAATT  TTACAATGAACTCACTGGCCAGTTTAGGAACAGAGTCATC AATACCAAAAGTTTTGGTGGTCAATGTAGAAAGGTGTT TAGTGGGGATGGAAAAGATTTCTACAGGCTGAGTGGAA ATGTCCTGTCCTATACATTCCAG 
TGCATTTGTGCCAAT GAAGAGC ATTTATACTGGCC AGGCACA TGC-TTTGTGCCA ATGAAGAGC
A is missing in FWD 
GTGAAAATAAATAATGATTTTAATTATGAATTTTACAATA GTACTTGGTCTTATGTAAAACATACGTCGACAGAACAC ACATCATCTAGTCGGAAGCGCTCCTTTTTTAGATCTTC ATCATCTTCTTCACGCAGTTATACTTCACATACCAATG AAATCCATAAAGGAAAG 
TTGGTTGATTGGA GATGAGAGC AGGCATTTCTGGGA TTTTAATGGG  AGTTACCAACTGCTGGTTGTTGAGAACACTGTTGAAGTGG CTCAGTTCATTAATAACAATCCAGAATTTTTACAACTT GCTGAGCCATTCTGGAAGGAGCTTTCCCACCTCCCCTC TCTGTATGACTACAGTGCCTACCGAAGATTAATCGACC AGTACGGGACACATTATCTGCAATCTGGGTCGTTAGGA GGAGAATACAGAGTTCTATTTTATGTGGACTCAGAAAA ATTAAAACAAAATG 
TCACTCTTGATT AGATGGCC GGTAAACTTGTG TCATGGGG  ATTTTAATTCAGTCGAAGAAAAGAAATGTAAATCCTCAGG TTGGCATTTTGTCGTTAAATTTTCAAGTCATGGATGCA AGGAACTGGAAAACGCTTTAAAAGCTGCTTCAG 
10 GCTCTGCCTATTCA TCCCTCCC AATTAGCATTTTCC GTATCCCAAT  GAACCCAGAACAATGTATTGCGAGGAGAACCGTTCATCAG AGGGGGAGGTGCAGGCTTCATATCTGGCCTTAGTTACC TAGAGCTGGACAATCCTGCTGGAAACAAAAGGCGATAT TCTGCCTGGGCAGAATCTGTGACTAATCTTCCTCAAGT CATAAAACAAAAG 
10 11 TAACAAACTTACCCGTGGCT CCCTGTTTCTC TGCTCCTTG TAACAAACTTGCCCGTGGCT
G replaces A in FWD 
CTGACACCTTTATATGAGCTGGTAAAGGAAGTACCTTGTG CCTCTGTGAAAAAACTATACCTGAAATGGGCTCTTGAA GAGTATCTGGATGAATTTGACCCCTGTCATTGCCGGCC TTGTCAAAATGGTGGTTTGGCTACTGTTGAGGGGACCC ATTGTCTGTGCCATTGCAAACCGTACACATTTGGTGCG GCGTGTGAGCAAGGAGTCCTCGTAGGGAATCAAGCAG 
11 12 TTGTTAGCAGG AAGCATAGC GGCTATTTTTA CCAGGGACT  GAGGGGTTGATGGAGGTTGGAGTTGCTGGTCCTCTTGGAG CCCCTGTGTCCAAGGGAAGAAAACAAGAAGCCGTGAAT GCAATAACCCACCTCCCAGTGGGGGTGGGAGATCCTGC GTTGGAGAAACGACAGAAAGCACACAATGCGAAGATG AGGAGCTGGAGCACTTGAG 
12 13 GATACAAAGGAG AAATCCAACG TCTTCCTCCA TGGTGAAG  GTTGCTTGAACCACATTGCTTTCCTTTGTCTTTGGTTCCA ACAGAATTCTGTCCATCACCTCCTGCCTTGAAAGATGGA TTTGTTCAA 
13 14 GCTTGCCTGATG ATTATGATTT GAATAAGCCC TCCGCCT  GATGAAGGTACAATGTTTCCTGTGGGGAAAAATGTAGTGT ACACTTGCAATGAAGGATACTCTCTTATTGGAAACCCA GTGGCCAGATGTGGAGAAGATTTACGGTGGCTTGTTGG GGAAATGCATTGTCAGA 
14 15 CGTCTTCCTCC TTGTCCTCT ACCCAGGCAAG TGAGAGTCC  AAATTGCCTGTGTTCTACCTGTACTGATGGATGGCATACA GAGTCACCCCCAAAAACCTTTCTACACAGTTGGTGAGA AGGTGACTGTTTCCTGTTCAGGTGGCATGTCCTTAGAA GGTCCTTCAGCATTTCTCTGTGGCTCCAGCCTTAAGTG GAGTCCTGAGATGAAGAATGCCCGCTGTGTACAAAAAG 
15 16 AAGAGGCTTTTC TCCTAACG TGTTGGATGGA AGGTGTAGC  AAAATCCGTTAACACAGGCAGTGCCTAAATGTCAGCGCTG GGAGAAACTGCAGAATTCAAGATGTGTTTGTAAAATGC CCTACGAATGTGG 
16 17 AACATCTGGGG GCACTAAGC ATAAGAATGCTAAA GTCACAGTAC  ACCTTCCTTGGATGTATGTGCTCAAGATGAGAGAAGCAA AAGGATACTGCCTCTGACAGTTTGCAAGATGCATGTT CTCCACTGTCAGGGTAGAAATTACACCCTTACTGGTA GGGACAGCTGTACTCTGCCTGCCTCAGCTGAGAAAGC TTGTGGTGCCTGCCCACTGTGGGGAAAATGTGATG 
17 18 CCCAATTTCC TGGTCCTA TTACCTTCTC TGGGCCTT  CTGAGAGCAGCAAATGTGTCTGCCGAGAAGCATCGG AGTGCGAGGAAGAAGGGTTTAGCATTTGTGTGGAAGT GAACGGCAAGGAGCAGACGATGTCTGAGTGTGAGGCG GGCGCTCTGAGATGCAGAGGGCAGAGCATCTCTGTCAC CAGCATAAGGCCTTGTGCTGCGGAAACCCAGTAG 

The exon numbers and primers used by Fernie et al. (59) are shown, along with the reverse complement primers. The updated exon numbers are annotated according to the numbering criteria provided by current gene databases. The primers were revised and corrected according to the primers provided for the current C7 sequence reference (NG_011692.1), together with the amplified sequences of C7 exons. The first run of nucleotides (bold, underlined) is not incorporated within the amplified exons. Bold indicates nucleotides affected by changes; dash represents deleted nucleotide position.

FWD, forward; N/A; not available; REV, reverse.

To this end, the shift in exon numbering and the discrepancy in the length of the amino acid sequences must be taken into account on updating C6 and C7 nomenclature. We propose that the outdated nomenclature be revised according to the numbering system used by current genome browsers. Thus, the location of previously described C6 and C7 variants should be amended by the addition of one unit to the exon number. Furthermore, previously described amino acid locations must be revised such that 21 or 22 aa are added to the identified C6 and C7 variants, respectively. The revised exon and amino acid location of different C6 and C7 variants are described in Tables III and V. Moreover, it is of great importance that future discoveries of C6 and C7 variants are defined according to the updated numbering system as means of preventing any future confusion pertaining to the nomenclature.

Table III.

Updated nomenclature of C6 variants

PhenotypeExon No. [Position in cDNA]Amino Acid [Old Nomenclature]Ref/Alt Alleles as Described in Referenced ArticleRef/Alt Alleles as Found in Genome BrowsersResultant ProteinPopulation Ref Allele Is Most Frequent/Total FrequencyaVariant IDchr-pos-ref-alt IDPosition (GRCh37)Position (GRCh38)References
C6D 2 [143] R48K [R27K] G/A C/T Missense variant 0.0004 (Other)/0.0002 rs145422926 5-41203088-C-T 41203190 41203088 60  
C6Q0 3 [234–237] P79X [P58X] 1-bp deletion (C) GGGG/GGG Frameshift variant
Addition of 42 abnormal aa followed by premature stop codon in exon 3 
0.0006 (Japanese)b rs398122811 5-41201620-GG-G 4120172–41201726 41201621–41201624 51  
C6 A/B 4 [356] A119E [A98E] C/A G/T Missense variant
C6A identified by glutamic acid; C6B identified by alanine 
0.6353 (European [non-Finnish])/0.5936 rs1801033 5-41199857-G-T 41199959 41199857 52  
C6D 7 [821] Q274X [Q253X] 1-bp deletion (A) T/- Frameshift variant
Addition of 45 abnormal aa followed by premature stop codon in exon 8 
0.004 (African/African American)/0.0012c rs557023458 5-41181464-CT-C 41181567 41181465 6164  
C6Q0 879delG 7 [822–828] G276X [G255X] 1-bp deletion (G), arbitrarily ascribed to first run of 7 Gs at position 879 CCCCCCC/CCCCCC/CCCCCCCC Frameshift variant
Addition of 1 sense and 15 non-sense aa followed by a premature stop codon 
0.00021 (South Asian)/0.00005c rs372345940 5-41181457-T-TC 4118156–41181566 41181458–41181464 33  
C6D/C6Q0 1195delG 8 [1138] Q380X [Q359X] 1-bp deletion (C) G/- Frameshift variant
Addition of 6 abnormal aa followed by premature stop codon 
0.0066 (African/African American)/0.0019c rs375762365 5-41176504-TG-T 41176607 41176505 33, 65  
N/A 11 [1617] C539C [C518C] T/C A/G Synonymous variant 0.0391 (East Asian)/0.0045 rs2287901 5-41160209-A-G 41160311 41160209 66  
N/A 12 [1694] D565G [D544G] A/G T/C Missense variant N/A N/A 5-41159244-T-C 41159346 41159244 66  
N/A 12 [1695] D565D [D544D] or D565E C/T G/A
G/Td 
Synonymous variant
Missense variant 
0.0387 (East Asian)/0.0031
0.000009 (European [non-Finnish])/0.000004 
rs79523005 5-41159243-G-A
5-41159243-G-T 
41159345 41159243 66  
N/A 12 [1701] Q567H [Q546H]
Q567Q 
G/C C/G
C/Td 
Missense variant
Synonymous variant 
0.0387 (East Asian)/0.0031
0.000009 (European [non-Finnish])/0.000004 
rs80108105 5-41159237-C-G
5-41159237-C-T 
41159339 41159237 66  
C6Q0 12 [1786] R596X [R575X] C/T G/A Stop gained 0.0019 (Ashkenazi Jewish)/0.0001 rs142881576 5-41159152-G-A 41159254 41159152 8  
N/A 12 [1787] R596Q [R575Q] G/A C/T Missense variant 0.0028 (Ashkenazi Jewish)/0.0002 rs148521858 5-41159151-C-T 41159253 41159151 66  
C6Q0 13 [1816] R606X [R585X] C/T G/A Stop gained 0.0002 (East Asian)/0.00002 rs191386155 5-41159122-G-A 41159224 41159122 8  
C6D/C6Q0 1936delG 13 [1879] D627X [D606X] 1-bp deletion (G) C/- Frameshift variant
Addition of 3 abnormal aa followed by premature stop codon 
0.0113 (African/African American)/0.0011 rs61469168 5-41158762-TC-T 41158865 41158763 33, 51, 65  
N/A 13 [1928] G643E [G622E] G/A C/T Missense variant 0.0012 (Latino/Admixed American)/0.00003 rs1405281849 5-41158714-C-T 41158816 41158714 66  
N/A 13 [1952] E651G [E630G] A/G T/C Missense variant N/A N/A 5-41158690-T-C 41158791 41158689 66  
NA 14 [2101] R701W [R680W] C/T G/A
G/Td
G/Cd 
Missense variant 0.0006 (Latino/Admixed American)/0.0001
0.0001 (South Asian)/0.00002
0.0001 (South Asian)/0.00002 
rs199930769 5-41154972-G-A
5-41154972-G-T
5-41154972-G-C 
41155074 41154972 66  
C6SD 17 [2599] C867R T/C A/G Stop gained
Truncated protein as a result of premature stop codon 55 nucleotides downstream of variant 
Caucasian subject CM140788 5-41149265-A-G 41149367 41149265 67  
PhenotypeExon No. [Position in cDNA]Amino Acid [Old Nomenclature]Ref/Alt Alleles as Described in Referenced ArticleRef/Alt Alleles as Found in Genome BrowsersResultant ProteinPopulation Ref Allele Is Most Frequent/Total FrequencyaVariant IDchr-pos-ref-alt IDPosition (GRCh37)Position (GRCh38)References
C6D 2 [143] R48K [R27K] G/A C/T Missense variant 0.0004 (Other)/0.0002 rs145422926 5-41203088-C-T 41203190 41203088 60  
C6Q0 3 [234–237] P79X [P58X] 1-bp deletion (C) GGGG/GGG Frameshift variant
Addition of 42 abnormal aa followed by premature stop codon in exon 3 
0.0006 (Japanese)b rs398122811 5-41201620-GG-G 4120172–41201726 41201621–41201624 51  
C6 A/B 4 [356] A119E [A98E] C/A G/T Missense variant
C6A identified by glutamic acid; C6B identified by alanine 
0.6353 (European [non-Finnish])/0.5936 rs1801033 5-41199857-G-T 41199959 41199857 52  
C6D 7 [821] Q274X [Q253X] 1-bp deletion (A) T/- Frameshift variant
Addition of 45 abnormal aa followed by premature stop codon in exon 8 
0.004 (African/African American)/0.0012c rs557023458 5-41181464-CT-C 41181567 41181465 6164  
C6Q0 879delG 7 [822–828] G276X [G255X] 1-bp deletion (G), arbitrarily ascribed to first run of 7 Gs at position 879 CCCCCCC/CCCCCC/CCCCCCCC Frameshift variant
Addition of 1 sense and 15 non-sense aa followed by a premature stop codon 
0.00021 (South Asian)/0.00005c rs372345940 5-41181457-T-TC 4118156–41181566 41181458–41181464 33  
C6D/C6Q0 1195delG 8 [1138] Q380X [Q359X] 1-bp deletion (C) G/- Frameshift variant
Addition of 6 abnormal aa followed by premature stop codon 
0.0066 (African/African American)/0.0019c rs375762365 5-41176504-TG-T 41176607 41176505 33, 65  
N/A 11 [1617] C539C [C518C] T/C A/G Synonymous variant 0.0391 (East Asian)/0.0045 rs2287901 5-41160209-A-G 41160311 41160209 66  
N/A 12 [1694] D565G [D544G] A/G T/C Missense variant N/A N/A 5-41159244-T-C 41159346 41159244 66  
N/A 12 [1695] D565D [D544D] or D565E C/T G/A
G/Td 
Synonymous variant
Missense variant 
0.0387 (East Asian)/0.0031
0.000009 (European [non-Finnish])/0.000004 
rs79523005 5-41159243-G-A
5-41159243-G-T 
41159345 41159243 66  
N/A 12 [1701] Q567H [Q546H]
Q567Q 
G/C C/G
C/Td 
Missense variant
Synonymous variant 
0.0387 (East Asian)/0.0031
0.000009 (European [non-Finnish])/0.000004 
rs80108105 5-41159237-C-G
5-41159237-C-T 
41159339 41159237 66  
C6Q0 12 [1786] R596X [R575X] C/T G/A Stop gained 0.0019 (Ashkenazi Jewish)/0.0001 rs142881576 5-41159152-G-A 41159254 41159152 8  
N/A 12 [1787] R596Q [R575Q] G/A C/T Missense variant 0.0028 (Ashkenazi Jewish)/0.0002 rs148521858 5-41159151-C-T 41159253 41159151 66  
C6Q0 13 [1816] R606X [R585X] C/T G/A Stop gained 0.0002 (East Asian)/0.00002 rs191386155 5-41159122-G-A 41159224 41159122 8  
C6D/C6Q0 1936delG 13 [1879] D627X [D606X] 1-bp deletion (G) C/- Frameshift variant
Addition of 3 abnormal aa followed by premature stop codon 
0.0113 (African/African American)/0.0011 rs61469168 5-41158762-TC-T 41158865 41158763 33, 51, 65  
N/A 13 [1928] G643E [G622E] G/A C/T Missense variant 0.0012 (Latino/Admixed American)/0.00003 rs1405281849 5-41158714-C-T 41158816 41158714 66  
N/A 13 [1952] E651G [E630G] A/G T/C Missense variant N/A N/A 5-41158690-T-C 41158791 41158689 66  
NA 14 [2101] R701W [R680W] C/T G/A
G/Td
G/Cd 
Missense variant 0.0006 (Latino/Admixed American)/0.0001
0.0001 (South Asian)/0.00002
0.0001 (South Asian)/0.00002 
rs199930769 5-41154972-G-A
5-41154972-G-T
5-41154972-G-C 
41155074 41154972 66  
C6SD 17 [2599] C867R T/C A/G Stop gained
Truncated protein as a result of premature stop codon 55 nucleotides downstream of variant 
Caucasian subject CM140788 5-41149265-A-G 41149367 41149265 67  

For every C6 variant, the updated exon and cDNA positions are stated to refer to the location of the variant. The updated amino acid positions are shown, along with the old nomenclature noted in brackets. The Ref allele and Alt allele are indicated for each variant. Variant ID refers to either the rsID (from dbSNPs), HGMD accession number, or N/A if the variant was not found in dbSNP or HGMD. chr-pos-ref-alt ID is a composite ID of each variant. GRCh37 and GRCh38 are human genome assemblies compiled by the Genome Reference Consortium Human Genome.

a

The frequencies are of the Alt allele and are reported from gnomAD v2.1.1 unless otherwise noted.

b

The frequencies are of the Alt allele and are reported from the original article.

c

The frequencies are of the Alt allele and are reported from gnomAD v3.1.1.

d

Additional Alt alleles have also been described in genome browsers.

aa, amino acids; Alt, alternative; C6D, C6 deficiency; chr-pos-ref-alt, chromosome, position, reference, and alternate; HGMD, Human Gene Mutation Database; Ref, reference.

RNA processing is a vital mechanism that ensures the regulation of gene expression and the production of a diverse array of proteins from a select gene pool (37). RNA splicing events are mainly characterized by constitutive splicing and alternative splicing.

Constitutive splicing is defined by the excision of introns and the ligation of exons in the order that they are located within a gene (Fig. 2A). During alternative splicing, some exons may be skipped, and 5′ and 3′ splice sites may vary depending on the splicing event (38, 39). There are four main subtypes of alternative splicing, namely, cassette alternative exon, alternative 3′ splice site, alternative 5′ splice site, and intron retention (38). One critical factor that dictates the products of alternative splicing is whether the event occurs in symmetrical or nonsymmetrical exons. This phenomenon can be distinctly demonstrated during intron retention (40, 41).

FIGURE 2.

mRNA processing by constitutive and alternative splicing. The diagram illustrates the processing of pre-mRNA into mature mRNA by (A) constitutive splicing and (B and C) alternative splicing with intron retention. Alternative splicing with the retention of intronic sequences (orange) results in a shift in the reading frame, which is dictated by whether the alternatively spliced exons are (B) symmetrical or (C) nonsymmetrical.

FIGURE 2.

mRNA processing by constitutive and alternative splicing. The diagram illustrates the processing of pre-mRNA into mature mRNA by (A) constitutive splicing and (B and C) alternative splicing with intron retention. Alternative splicing with the retention of intronic sequences (orange) results in a shift in the reading frame, which is dictated by whether the alternatively spliced exons are (B) symmetrical or (C) nonsymmetrical.

Close modal

Intron retention occurs when certain intronic sequences are added to the mature mRNA (42). It is one of the least understood forms of RNA splicing; however, it has been recognized for its regulation of gene expression in mammalian cells (43). The introduction of an intron evidently alters the reading frame of the mature mRNA; thus, the resulting sequence is governed by the type of exon that incorporates an intron. Symmetrical and nonsymmetrical exons are distinguished by the phase, which refers to the position of an intron with respect to the nucleotide triplets that make up a codon. Introns are defined by three phases. Introns of phase 0 lie between intact codons and thus do not disrupt the position of the codons. Phase 1 and phase 2 introns interrupt the first and second nucleotides of a codon, or the second and third nucleotides, respectively (44). Symmetrical exons are exons that are flanked by phase 0 introns; thus, nucleotides of symmetrical exons are divisible by three. Nucleotides of nonsymmetrical exons are not divisible by three as they are flanked by introns of either phase 1 or phase 2. Consequently, intron retention introduces a frameshift in nonsymmetrical exons (45, 46). This concept is illustrated in (Fig. 2B and 2C.

Because introns retained in symmetrical exons do not disrupt the nucleotide sequence, the exon reading frame remains unmodified (Fig. 2B). In symmetrical exons, the addition of introns to a mature mRNA could result in a premature stop codon, leaving the exons prior to intron retention intact, while some or all subsequent exons may be skipped during translation. However, in nonsymmetrical exons, retained introns interrupt the reading frame of the exon nucleotide sequence, ultimately altering the amino acid composition translated from the final mRNA product (47, 48). In the example illustrated in (Fig. 2C, the retained introns interfere with the reading frame of the last nucleotide triplet (TGT), which is flanked by a phase 1 intron. As a result, the two coding nucleotides (TG) are completed by an intronic nucleotide (G). This shift in the reading frame causes an amino acid substitution, from a cysteine to a tryptophan. The hanging nucleotide (T) located in the following exon would not be translated into the final polypeptide chain because of the premature stop codon produced by the intronic sequence.

Because splicing of nonsymmetrical exons can result in complex frameshifts, variants in proximity of intron/exon boundaries could have relevant consequences. This can be observed in a specific C7 SNP, rs74480769 (A/G). This SNP is located in intron 14 and is associated with multiple protein levels as described in a recent GWAS (49). In the GRCh37/hg19 genome build, rs74480769 was annotated in an alternative transcript featuring a 102-bp cassette exon (chr5:40972110–40972211), corresponding to the last nucleotide of the cassette exon. Because exon 14 is nonsymmetrical, alternative splicing with the retention of the cassette exon would lead to a premature stop codon in the resulting transcript (Fig. 3).

FIGURE 3.

Molecular structure of C7 with mapped C7 SNP (rs74480769). The rs74480769 SNP lies in intron 14 and corresponds to the last nucleotide (A>G, purple) of a 102-bp hypothetical exon that could induce alternative splicing featuring a cassette exon. The cassette exon would introduce a premature stop codon in frame, resulting in a truncated C7 protein. Forty nucleotides are present between the premature stop codon and the C7 SNP. Given that exon 14 is nonsymmetrical, the last nucleotide (A, arrow) would be joined by the two nucleotides located in exon 15 during constitutive splicing. However, if alternative splicing introduces a cassette exon, the overhanging nucleotide in exon 14 would be completed by the nucleotides present in the cassette exon (AC, orange), thereby introducing a premature stop codon within frame (red, underlined).

FIGURE 3.

Molecular structure of C7 with mapped C7 SNP (rs74480769). The rs74480769 SNP lies in intron 14 and corresponds to the last nucleotide (A>G, purple) of a 102-bp hypothetical exon that could induce alternative splicing featuring a cassette exon. The cassette exon would introduce a premature stop codon in frame, resulting in a truncated C7 protein. Forty nucleotides are present between the premature stop codon and the C7 SNP. Given that exon 14 is nonsymmetrical, the last nucleotide (A, arrow) would be joined by the two nucleotides located in exon 15 during constitutive splicing. However, if alternative splicing introduces a cassette exon, the overhanging nucleotide in exon 14 would be completed by the nucleotides present in the cassette exon (AC, orange), thereby introducing a premature stop codon within frame (red, underlined).

Close modal

This non-RefSeq alternative transcript is no longer annotated in the current GRCh38/hg19 genome build. It was possibly annotated as a result of a bioinformatics prediction, and is no longer present in the current GRCh38/hg19 genome build. However, given the evidence from GWASs, the functional follow-up of rs74480769, including the validation of this alternative transcript using real-time PCR, may be of interest.

We compiled a list of C6 variants previously found in complement-deficient individuals. We defined their consequence to transcript and described their frequency as currently reported in public databases such as gnomAD. Importantly, we reported the updated exon number along with the former and updated nomenclature for each variant (Table III). We further matched this nomenclature, when possible, to the reference sequence (“rs”) variant code, as found in dbSNP at NCBI (https://www.ncbi.nlm.nih.gov/snp/), and with a variant identifier combining chromosome, position, reference, and alternate alleles that is more flexible and avoids any ambiguity in variant identification, as found in the gnomAD database. The C6 gene is located on the reverse strand of chromosome 5; while independent publications described the variants on the reverse strand, genome browsers translated the location to the forward strand by default. To accommodate both sources of information, the table describes the allele location as reported by both the referenced papers and the genome browsers. Intronic variants have also been characterized by independent researchers in individuals affected by complement deficiency in the 1990s. A list of variants pinpointed within C6 introns can be found in Table IV, with the hypothesized consequence to transcript.

Table IV.

Variants identified in intronic regions of C6

PhenotypeIntron No.Amino Acid [Old Nomenclature]Ref/Alt Alleles as Described in Referenced ArticleRef/Alt Alleles as Found in Genome BrowsersLikely Resultant ProteinPopulation Ref Allele Is Most Frequent/Total FrequencyaIDchr-pos-ref-alt IDPosition (GRCh37)Position (GRCh38)References
C6D 11 N/A Deletion of 6 bp and insertion of 26 bp -/TACTA/TACTAACTAT TACTTAGAAATA Net gain of 20 bp in intron 11 0.0216 (Europeans)/0.0153 rs541722694 5-41159645-T-TTACTAACTATTACTTAGAAATA 41159747–41159748 41159645–41159646 68  
C6SD 16 S794R [S773R] G/T C/T Splice donor variant
Truncated protein as a result of addition of 17 abnormal aa and deletion of 140 aa 
2 South African families, 2 Caucasians, and 2 Caucasians with combined C6SD/C7SDb rs775701923 5-41149934-
C-T 
41150036 41149934 7, 9  
PhenotypeIntron No.Amino Acid [Old Nomenclature]Ref/Alt Alleles as Described in Referenced ArticleRef/Alt Alleles as Found in Genome BrowsersLikely Resultant ProteinPopulation Ref Allele Is Most Frequent/Total FrequencyaIDchr-pos-ref-alt IDPosition (GRCh37)Position (GRCh38)References
C6D 11 N/A Deletion of 6 bp and insertion of 26 bp -/TACTA/TACTAACTAT TACTTAGAAATA Net gain of 20 bp in intron 11 0.0216 (Europeans)/0.0153 rs541722694 5-41159645-T-TTACTAACTATTACTTAGAAATA 41159747–41159748 41159645–41159646 68  
C6SD 16 S794R [S773R] G/T C/T Splice donor variant
Truncated protein as a result of addition of 17 abnormal aa and deletion of 140 aa 
2 South African families, 2 Caucasians, and 2 Caucasians with combined C6SD/C7SDb rs775701923 5-41149934-
C-T 
41150036 41149934 7, 9  

For every C6 variant, the updated exon and cDNA positions are stated to refer to the location of the variant. The updated amino acid positions are shown, along with the old nomenclature noted in brackets. The Ref allele and Alt allele are indicated for each variant. Variant ID refers to either the rsID (from dbSNPs), HGMD accession number, or N/A if the variant was not found in dbSNP or HGMD. chr-pos-ref-alt ID is a composite ID of each variant. GRCh37 and GRCh38 are human genome assemblies compiled by the Genome Reference Consortium Human Genome.

a

The frequencies indicated refer to the Alt allele and are reported from gnomAD v2.1.1 unless otherwise noted.

b

The frequencies indicated refer to the Alt allele and are reported from the original article.

aa, amino acids; Alt, alternative; C6D, C6 deficiency; C6SD/C7SD, C6 and C7 combined subtotal deficiency; chr-pos-ref-alt, chromosome, position, reference, and alternate; HGMD, Human Gene Mutation Database; Ref, reference.

We have similarly showcased the updated nomenclature and genomic location for the majority of the published C7 variants resulting in C7 deficiencies (Table V). We additionally compiled a list of C7 variants located in intronic regions (Table VI).

Updated nomenclature of C7 variants

PhenotypeExon No. [Position in cDNA]Amino Acid [Old Nomenclature]Ref/Alt Alleles as Described in Referenced ArticleResultant ProteinPopulation Ref Allele Is Most Frequent/Total FrequencyaIDchr-pos-ref-alt IDPosition (GRCh37)Position (GRCh38)References
C7Q0 2 [90] W30X [W8X] G/A Stop gained
Truncated protein (molecular size is 1% of normal C7) because of a premature stop codon 
Spanish familyb CM104165 5-40931091-G-A 40931193 40931091 69  
C7D 7 [631–643] T211x215X [T189x193X] 11-bp deletion (ACGTCGACAGA) Frameshift variant
Truncated protein because of a premature stop codon 
0.0002 (European [non-Finnish])/0.0001 rs770367814 5-40945260-TACGTCGACAGA-T 40945363–40945375 40945261–40945273 70  
C7Q0 7 [659] R220Q [R198Q] G/A Missense variant 0.0007 (East Asian)/0.0001 rs369349760 5-40945289-G-A 40945391 40945289 59  
C7Q0 8 and 9 N/A Deletion of exons 8 and 9 Addition of 26 non-sense aa after exon 7 followed by a premature stop codon in exon 10 5 Irish subjectsb N/A N/A N/A N/A 34, 71  
C7Q0 10 [1135] G379R [G357R]
G379W 
G/C
G/Ad
G/Td 
Missense variant 0.0001(Latino/Admixed American)/0.0001
0.0063 (Middle Eastern)/0.0001
0.0004 (Latino/Admixed American)/0.0001 
rs121964921 5-40955428-G-C
5-40955428-G-A
5-40955428-G-T 
40955530 40955428 34  
C7D 10 [1166] S389T [T367S] G/C Missense variant 0.6651 (Ashkenazi Jewish)/0.5701 rs1063499 5-40955459-G-C 40955561 40955459 72, 73  
C7D 10 [1258] K420Q A/C Missense variant 0.0325 (East Asian)/0.0029 rs3792646 5-40955551-A-C 40955653 40955551 74  
C7D 11 [1309] K438–441X
[K416–419X] 
1-bp deletion (A) Frameshift variant
Addition of 3 non-sense aa 
Spanish familyb CD045232 5-40958085-AA-A 40958188 40958086 75  
C7Q0 11 [1424] C475Y [C453Y] G/A Missense variant 0.00006 (East Asian)/0.000008 rs374971959 5-40958196-G-A 40958298 40958196 76  
C7D 11 [1458] C486X [C464X] T/A Stop gained Spanish subjectb rs121964922 5-40958230-T-A 40958332 40958230 70  
C7SD 12 [1561] R521S [R499S]
R521C 
C/A
C/Td 
Missense variant 0.0041 (European [non-Finnish])/0.0024
0.00008 (African/African American)/0.00003 
rs121964920 5-40959520-C-A
5-40959520-C-T 
40959622 40959520 53  
C7 M/N 14 [1759] T587P [T565P] C/A Missense variant
C7M identified by threonine; C7N identified by proline 
0.3751 (South Asian)/0.2354 rs13157656 5-40964750-C-A 40964852 40964750 55  
C7D 14 [1792] T598S [T576S] A/T Missense variant 0.1717 (European [Finnish])/0.1167 rs770155291 5-40964783-A-T 40964858 40964756 77  
C7D 15 [1922–1925] S642X [S620–630X] 2-bp deletion (AG) Frameshift variant
Addition of 10 non-sense aa followed by a premature stop codon 
0.0006 (Latino/Admixed American)/0.00009c rs764871530 5-40972441-CAG-C 40972544–40972547 40972442–40972445 70  
C7Q0 15 [1929–1933] Q645X [Q623X] 1-bp deletion (A) Frameshift variant
Addition of 9 non-sense aa followed by a premature stop codon 
Russian familyb rs35196116 5-40972454-AA-A 40972556 40972454 59  
C7D 15 [1957] E653X [E631X] G/T Stop gained Spanish familyb CM994345 5-40972477-G-T 40972579 40972477 78  
C7Q0 15 [2044] E682Q [E660Q] G/C Missense variant African lineage subjectb rs541873000 5-40972564-G-C 40972666 40972564 59  
C7Q0 15 [2060] R687H [R665H]
R687L 
G/A
G/Td 
Missense variant 0.0053 (African/African American)/0.0005
0.00008 (African/African American)/0.00002 
rs113187203 5-40972580-G-A
5-40972580-G-T 
40972682 40972580 59  
C7Q0 15 [2466] Q703X [Q681X] C/T Stop gained Spanish familyb CM074721 5-40976782-C-T 40976884 40976782 69  
C7D 16 [2137–2141] V714L [V692L] 2-bp deletion (GT) Frameshift variant
Truncated protein because of premature stop codon 
0.0002 (East Asian)/0.000007c rs1467298230 5-40976811-ATG-A 40976914–40976918 40976812–40976816 79  
C7D 17 [2250] C750X [C728X] T/A Stop gained Japanese subjectb rs121964919 5-40979809-T-A 40979911 40979809 79  
C7Q0 17 [2350] A784V [A762V] 1-bp deletion (G) Splice donor variant
Addition of 7 non-sense 
0.0002 (European [non-Finnish])/0.0001 rs779723422 5-40979908-TG-T 40980011 40979909 59  
PhenotypeExon No. [Position in cDNA]Amino Acid [Old Nomenclature]Ref/Alt Alleles as Described in Referenced ArticleResultant ProteinPopulation Ref Allele Is Most Frequent/Total FrequencyaIDchr-pos-ref-alt IDPosition (GRCh37)Position (GRCh38)References
C7Q0 2 [90] W30X [W8X] G/A Stop gained
Truncated protein (molecular size is 1% of normal C7) because of a premature stop codon 
Spanish familyb CM104165 5-40931091-G-A 40931193 40931091 69  
C7D 7 [631–643] T211x215X [T189x193X] 11-bp deletion (ACGTCGACAGA) Frameshift variant
Truncated protein because of a premature stop codon 
0.0002 (European [non-Finnish])/0.0001 rs770367814 5-40945260-TACGTCGACAGA-T 40945363–40945375 40945261–40945273 70  
C7Q0 7 [659] R220Q [R198Q] G/A Missense variant 0.0007 (East Asian)/0.0001 rs369349760 5-40945289-G-A 40945391 40945289 59  
C7Q0 8 and 9 N/A Deletion of exons 8 and 9 Addition of 26 non-sense aa after exon 7 followed by a premature stop codon in exon 10 5 Irish subjectsb N/A N/A N/A N/A 34, 71  
C7Q0 10 [1135] G379R [G357R]
G379W 
G/C
G/Ad
G/Td 
Missense variant 0.0001(Latino/Admixed American)/0.0001
0.0063 (Middle Eastern)/0.0001
0.0004 (Latino/Admixed American)/0.0001 
rs121964921 5-40955428-G-C
5-40955428-G-A
5-40955428-G-T 
40955530 40955428 34  
C7D 10 [1166] S389T [T367S] G/C Missense variant 0.6651 (Ashkenazi Jewish)/0.5701 rs1063499 5-40955459-G-C 40955561 40955459 72, 73  
C7D 10 [1258] K420Q A/C Missense variant 0.0325 (East Asian)/0.0029 rs3792646 5-40955551-A-C 40955653 40955551 74  
C7D 11 [1309] K438–441X
[K416–419X] 
1-bp deletion (A) Frameshift variant
Addition of 3 non-sense aa 
Spanish familyb CD045232 5-40958085-AA-A 40958188 40958086 75  
C7Q0 11 [1424] C475Y [C453Y] G/A Missense variant 0.00006 (East Asian)/0.000008 rs374971959 5-40958196-G-A 40958298 40958196 76  
C7D 11 [1458] C486X [C464X] T/A Stop gained Spanish subjectb rs121964922 5-40958230-T-A 40958332 40958230 70  
C7SD 12 [1561] R521S [R499S]
R521C 
C/A
C/Td 
Missense variant 0.0041 (European [non-Finnish])/0.0024
0.00008 (African/African American)/0.00003 
rs121964920 5-40959520-C-A
5-40959520-C-T 
40959622 40959520 53  
C7 M/N 14 [1759] T587P [T565P] C/A Missense variant
C7M identified by threonine; C7N identified by proline 
0.3751 (South Asian)/0.2354 rs13157656 5-40964750-C-A 40964852 40964750 55  
C7D 14 [1792] T598S [T576S] A/T Missense variant 0.1717 (European [Finnish])/0.1167 rs770155291 5-40964783-A-T 40964858 40964756 77  
C7D 15 [1922–1925] S642X [S620–630X] 2-bp deletion (AG) Frameshift variant
Addition of 10 non-sense aa followed by a premature stop codon 
0.0006 (Latino/Admixed American)/0.00009c rs764871530 5-40972441-CAG-C 40972544–40972547 40972442–40972445 70  
C7Q0 15 [1929–1933] Q645X [Q623X] 1-bp deletion (A) Frameshift variant
Addition of 9 non-sense aa followed by a premature stop codon 
Russian familyb rs35196116 5-40972454-AA-A 40972556 40972454 59  
C7D 15 [1957] E653X [E631X] G/T Stop gained Spanish familyb CM994345 5-40972477-G-T 40972579 40972477 78  
C7Q0 15 [2044] E682Q [E660Q] G/C Missense variant African lineage subjectb rs541873000 5-40972564-G-C 40972666 40972564 59  
C7Q0 15 [2060] R687H [R665H]
R687L 
G/A
G/Td 
Missense variant 0.0053 (African/African American)/0.0005
0.00008 (African/African American)/0.00002 
rs113187203 5-40972580-G-A
5-40972580-G-T 
40972682 40972580 59  
C7Q0 15 [2466] Q703X [Q681X] C/T Stop gained Spanish familyb CM074721 5-40976782-C-T 40976884 40976782 69  
C7D 16 [2137–2141] V714L [V692L] 2-bp deletion (GT) Frameshift variant
Truncated protein because of premature stop codon 
0.0002 (East Asian)/0.000007c rs1467298230 5-40976811-ATG-A 40976914–40976918 40976812–40976816 79  
C7D 17 [2250] C750X [C728X] T/A Stop gained Japanese subjectb rs121964919 5-40979809-T-A 40979911 40979809 79  
C7Q0 17 [2350] A784V [A762V] 1-bp deletion (G) Splice donor variant
Addition of 7 non-sense 
0.0002 (European [non-Finnish])/0.0001 rs779723422 5-40979908-TG-T 40980011 40979909 59  

For every C7 variant, the updated exon and cDNA positions are stated to refer to the location of the variant. The updated amino acid positions are shown, along with the old nomenclature noted in brackets. The Ref allele and Alt allele are indicated for each variant. Variant ID refers to either the rsID (from dbSNP), HGMD accession number, or N/A if the variant was not found in dbSNP or HGMD. chr-pos-ref-alt ID is a composite ID of each variant. GRCh37 and GRCh38 are human genome assemblies compiled by the Genome Reference Consortium Human Genome.

aThe frequencies indicated refer to the Alt allele and are reported from gnomAD v2.1.1 unless otherwise noted.

bThe frequencies indicated refer to the Alt allele and are reported from the original article.

cThe frequencies indicated refer to the Alt allele and are reported from gnomAD v3.1.1.

dAdditional Alt alleles have also been described in genome browsers.

aa, amino acids; Alt, alternative; C6D, C6 deficiency; chr-pos-ref-alt, chromosome, position, reference, and alternate; HGMD, Human Gene Mutation Database; Ref, reference.

Table VI.

Variants identified in intronic regions of C7

PhenotypeIntron No.Amino Acid [Old Nomenclature]Ref/Alt Alleles as Described in Referenced ArticleLikely Resultant ProteinPopulation Ref Allele Is Most Frequent/Total FrequencyaIDchr-pos-ref-alt IDPosition (GRCh37)Position (GRCh38)References
C7D G94D [G72D] G>A Splice acceptor variant
Addition of 12 missense aa followed by a premature stop codon 
0.000087 (Latino/Admixed American)/0.00001 rs759285960 5-40934467-G-A 40934569 40934467 34  
C7Q0 N/A G>T Splice acceptor variant
Truncated protein because of premature stop codon 
0.0015 (East Asian)/0.0001 rs531103546 5-40936337-G-T 40936439 40936337 76, 80  
C7Q0 D328X [D306X] G>A Splice donor variant
Addition of 19 non-sense aa followed by a premature stop codon 
0.00002 (African/African American)/0.000007b rs759368140 5-40947846-G-A 40947948 40947846 59  
C7SD 13 C713.-27 A/C
[C712.-27 A/C] 
C>A Intronic transversion 0.3485 (Middle Eastern)/0.2517 rs7713884 5-40964714-C-A 40964816 40964714 81  
C7Q0 s17 N/A T>C Splice donor variant
Addition of 17 non-sense aa 
0.0005 (European [non-Finnish])/0.003 rs201240159 c5-40979911-T-C 40980013 40979911 59  
PhenotypeIntron No.Amino Acid [Old Nomenclature]Ref/Alt Alleles as Described in Referenced ArticleLikely Resultant ProteinPopulation Ref Allele Is Most Frequent/Total FrequencyaIDchr-pos-ref-alt IDPosition (GRCh37)Position (GRCh38)References
C7D G94D [G72D] G>A Splice acceptor variant
Addition of 12 missense aa followed by a premature stop codon 
0.000087 (Latino/Admixed American)/0.00001 rs759285960 5-40934467-G-A 40934569 40934467 34  
C7Q0 N/A G>T Splice acceptor variant
Truncated protein because of premature stop codon 
0.0015 (East Asian)/0.0001 rs531103546 5-40936337-G-T 40936439 40936337 76, 80  
C7Q0 D328X [D306X] G>A Splice donor variant
Addition of 19 non-sense aa followed by a premature stop codon 
0.00002 (African/African American)/0.000007b rs759368140 5-40947846-G-A 40947948 40947846 59  
C7SD 13 C713.-27 A/C
[C712.-27 A/C] 
C>A Intronic transversion 0.3485 (Middle Eastern)/0.2517 rs7713884 5-40964714-C-A 40964816 40964714 81  
C7Q0 s17 N/A T>C Splice donor variant
Addition of 17 non-sense aa 
0.0005 (European [non-Finnish])/0.003 rs201240159 c5-40979911-T-C 40980013 40979911 59  

For every C7 variant, the updated exon and cDNA positions are stated to refer to the location of the variant. The updated amino acid positions are shown, along with the old nomenclature noted in brackets. The Ref allele and Alt allele are indicated for each variant. Variant ID refers to either the rsID (from dbSNP), HGMD accession number, or N/A if the variant was not found in dbSNP or HGMD. chr-pos-ref-alt ID is a composite ID of each variant. GRCh37 and GRCh38 are human genome assemblies compiled by the Genome Reference Consortium Human Genome.

a

The frequencies indicated refer to the Alt allele and are reported from gnomAD v2.1.1 unless otherwise noted.

b

The frequencies indicated refer to the Alt allele and are reported from gnomAD v3.1.1.

aa, amino acids; Alt, alternative; C6D, C6 deficiency; chr-pos-ref-alt, chromosome, position, reference, and alternate; HGMD, Human Gene Mutation Database; Ref, reference.

The last three decades have witnessed an unprecedented shift in the research paradigm with the discovery of millions of genetic variants thanks to the high-throughput technologies developed in genome sequencing programs. GWAS is used to test the association of a large number of genetic variants against multiple traits. Such novel approaches have proved to be extremely valuable; however, most of the current GWAS findings are still waiting for biological interpretation. It is therefore of paramount importance to link current findings with evidence already available as means of functional follow-up or downstream analyses. New findings may be elucidated by studies focusing on few but well-characterized genetic variants described in patients harboring extreme phenotypes. To achieve this, it is crucial to ensure that no relevant information is lost; hence nomenclature of variants and genomic coordinates must be harmonized between different sources. This report addressed the apparent inconsistency that exists in the nomenclature of numerous variants described in complement C6 and C7 genes. There is considerable discrepancy between the classification system used to describe variants in early published works and those used by current genomic databases. We thus highlighted the importance of using an official nomenclature system with a specific focus on the amino acid and exon numbering criteria in the hopes of unifying current and future C6 and C7 variant nomenclature and physical coordinates. We additionally matched this information with the standard SNPs rs code and with a variant identifier combining chromosome, position, reference, and alternate alleles that is more flexible and unambiguous, as found in the gnomAD database. The latter identifier will likely be the reference used in the future, given the increasing number of exome and whole-genome sequencing studies, and the consequent need of a simple and quick classification system for the increasing number of genetic variants.

One of the earliest descriptions of variants that lead to C6Q0 was reported in two unrelated individuals of African and Japanese origins (50). The variants were defined by two separate base-pair deletions resulting in a frameshift and the introduction of a premature stop codon. The premature termination of the C6 polypeptide chain prevents its secretion, and thus C6 is completely lacking in these individuals. The locations of the variants in the African and Japanese subjects were reported in exons 2 and 12, respectively (50). The position of the affected amino acid in exon 2 was determined to be at residue 58, resulting in a frameshift, the addition of 42 abnormal amino acids, and eventually a premature stop codon [P58X]. The base-pair deletion in exon 12 resulted in a missense variant at amino acid 606 [D606X]. Currently, the location of C6Q0 variants is reported in exon 13, while the amino acid position is shifted by 21 residues, modifying the nomenclature to P79X and D627X, respectively.

The shift in the exon and amino acid positions has also been observed in intronic variants, ultimately affecting the intron/exon boundary. For example, the C6SD was primarily described as a nucleotide transversion in intron 15 and is now known to be in intron 16, causing the addition of 17 new abnormal acids transcribed from intronic sequences (7) (Table IV).

The importance of harmonizing nomenclature can be exemplified by the C6 A/B polymorphism. This variant was initially assigned a wrong rsID number (rs121917779 instead of rs1801033) because of a unique coincidence. The location of the C6 A/B variant, originally described by Dewald et al. (51) as Glu98Ala, was calculated without considering the leader peptide. Incorporating the leader peptide into the mature protein would render the variant at position Ala119Glu. Coincidentally, the new amino acid numbering system also reports a Glu/Ala change at position 98, with the rsID code rs121917779, explaining why the C6 A/B polymorphism might have been automatically assigned the wrong rsID number. C6 A/B was properly relabeled as rs1801033, and the mistake in the genome browsers was corrected after contacting the helpdesk. This inconsistency was difficult to detect with automatic pipelines and was suspected after observing discrepancies in the allele frequencies; C6 A/B is frequent, whereas rs121917779 is rare (Fig. 4).

FIGURE 4.

Mapping of C6 A/B polymorphism. According to the current amino acid numbering, which includes the leader peptide (1–21, bold, underlined), Glu98Ala (bold) corresponds to the triallelic variant rs121917779 (T/C/G). The previously described C6 A/B polymorphism, or Glu98Ala, is now Ala(98 + 21)Glu→Ala119Glu (bold, italicized) and corresponds to rs1801033. The figure illustrates the first 120 aa only.

FIGURE 4.

Mapping of C6 A/B polymorphism. According to the current amino acid numbering, which includes the leader peptide (1–21, bold, underlined), Glu98Ala (bold) corresponds to the triallelic variant rs121917779 (T/C/G). The previously described C6 A/B polymorphism, or Glu98Ala, is now Ala(98 + 21)Glu→Ala119Glu (bold, italicized) and corresponds to rs1801033. The figure illustrates the first 120 aa only.

Close modal

An interesting phenomenon observed in complement deficiencies is that of C6 and C7 combined subtotal deficiency, where individuals express both C6 and C7 at very low concentrations in circulation (5254). A C7SD variant characterized by Fernie et al. (52) has been associated with the C6SD variant, S794R. The C7SD variant is caused by an arginine-to-serine substitution as a result of a nucleotide transversion (C>A). In the article authored by Fernie et al. (52), the location of the variant was reported in exon 11 at amino acid residue 499 [R499S]; however, given the shift in exons and the addition of the 22-long leader peptide, the location of the C7SD variant in current genome browsers is reported in exon 12 at amino acid residue 521, modifying the nomenclature to R521S (Table V).

Another variant worth highlighting is the C7 M/N polymorphism, of which the common allele is the C7M allele found in Caucasian, Japanese, Chinese, and South African individuals (55). The C7M and C7N alleles are distinguished by a neutral amino acid substitution at position 587 of exon 14, defined by the current numbering criteria (Table V). C7M and C7N are characterized by a threonine and a proline at position 587, respectively. C7N is a hypomorphic allele; thus, individuals carrying the C7N allele possess lower C7 concentrations compared with those with the C7M allele (56). Nevertheless, C7N has not been associated with diseases, especially meningococcal infections (5658).

The majority of the listed C7 variants lead to C7 deficiency, posing a risk for recurrent infections on carriers; thus, it is important to unify the nomenclature to facilitate any research pertaining to complement deficiencies and complement-deficient individuals.

A universal nomenclature system provides an accessible platform for studies investigating the clinical significance of C6 and C7 variants; it facilitates the identification of polymorphisms in population-based studies, assists in the interpretation of results generated by GWASs, and facilitates the reusage of data and results to perform meta-analyses and Mendelian randomization studies. It therefore represents a fundamental tool for the optimal usage of currently available resources, and for their future efficient matching with new findings.

This report is dedicated to the former Cambridge C6/C7 group members, Mike Hobart, Barbara Fernie, Ann Orren, and the late Sir Peter Lachmann.

This work was supported by the doctoral program of excellence HOROS (Austrian Science Fund, FWF, Vienna, Austria, ZFW12530, to M.M. and R.W.) and the Marie Skłodowska Curie action CORVOS (EC Horizon 2020 Framework Programme H2020-MSCA-ITN-2019, 860044, to M.M. and R.W.).

Abbreviations used in this article:

C6Q0

complete C6 deficiency

C6SD

C6 subtotal deficiency

dbSNP

Single Nucleotide Polymorphism Database

FIM

factor I module

GWAS

genome-wide association study

HGP

Human Genome Project

LDL

low-density lipoprotein receptor

MAC

membrane attack complex

MACPF

membrane attack complex perforin

SCR

short complement regulator

SNP

single-nucleotide polymorphism

TSP

thrombospondin

1.
Zhu
Y.
,
S.
Thangamani
,
B.
Ho
,
J. L.
Ding
.
2005
.
The ancient origin of the complement system.
EMBO J.
24
:
382
394
.
2.
Merle
N. S.
,
S. E.
Church
,
V.
Fremeaux-Bacchi
,
L. T.
Roumenina
.
2015
.
Complement system part I—molecular mechanisms of activation and regulation.
Front. Immunol.
6
:
262
.
3.
Ricklin
D.
,
G.
Hajishengallis
,
K.
Yang
,
J. D.
Lambris
.
2010
.
Complement: a key system for immune surveillance and homeostasis.
Nat. Immunol.
11
:
785
797
.
4.
Bubeck
D.
2014
.
The making of a macromolecular machine: assembly of the membrane attack complex.
Biochemistry
53
:
1908
1915
.
5.
Elvington
M.
,
M. K.
Liszewski
,
J. P.
Atkinson
.
2016
.
Evolution of the complement system: from defense of the single cell to guardian of the intravascular space.
Immunol. Rev.
274
:
9
15
.
6.
Würzner
R.
,
A.
Orren
,
P. J.
Lachmann
.
1992
.
Inherited deficiencies of the terminal components of human complement.
Immunodefic. Rev.
3
:
123
147
.
7.
Würzner
R.
,
M. J.
Hobart
,
B. A.
Fernie
,
D.
Mewar
,
P. C.
Potter
,
A.
Orren
,
P. J.
Lachmann
.
1995
.
Molecular basis of subtotal complement C6 deficiency. A carboxy-terminally truncated but functionally active C6.
J. Clin. Invest.
95
:
1877
1883
.
8.
Li
P. H.
,
W. W.
Wong
,
E. N.
Leung
,
C.-S.
Lau
,
E.
Au
.
2020
.
Novel pathogenic mutations identified in the first Chinese pedigree of complete C6 deficiency.
Clin. Transl. Immunology
9
:
e1148
.
9.
Orren
A.
,
R.
Würzner
,
P. C.
Potter
,
B. A.
Fernie
,
S.
Coetzee
,
B. P.
Morgan
,
P. J.
Lachmann
.
1992
.
Properties of a low molecular weight complement component C6 found in human subjects with subtotal C6 deficiency.
Immunology
75
:
10
16
.
10.
Ermini
L.
,
I. J.
Wilson
,
T. H. J.
Goodship
,
N. S.
Sheerin
.
2012
.
Complement polymorphisms: geographical distribution and relevance to disease.
Immunobiology
217
:
265
271
.
11.
Fakhouri
F.
,
M.
Fila
,
F.
Provôt
,
Y.
Delmas
,
C.
Barbet
,
V.
Châtelet
,
C.
Rafat
,
M.
Cailliez
,
J.
Hogan
,
A.
Servais
, et al
2017
.
Pathogenic variants in complement genes and risk of atypical hemolytic uremic syndrome relapse after eculizumab discontinuation.
Clin. J. Am. Soc. Nephrol.
12
:
50
59
.
12.
van den Broek
B.
,
M.
van der Flier
,
R.
de Groot
,
M. I.
de Jonge
,
J. D.
Langereis
.
2020
.
Common genetic variants in the complement system and their potential link with disease susceptibility and outcome of invasive bacterial infection.
J. Innate Immun.
12
:
131
141
.
13.
Visscher
P. M.
,
N. R.
Wray
,
Q.
Zhang
,
P.
Sklar
,
M. I.
McCarthy
,
M. A.
Brown
,
J.
Yang
.
2017
.
10 years of GWAS discovery: biology, function, and translation.
Am. J. Hum. Genet.
101
:
5
22
.
14.
Burgess
S.
,
A.
Butterworth
,
A.
Malarstig
,
S. G.
Thompson
.
2012
.
Use of Mendelian randomisation to assess potential benefit of clinical intervention.
BMJ
345
:
e7325
.
15.
Würzner
R.
,
K.
Witzel-Schlömp
,
K.
Tokunaga
,
B. A.
Fernie
,
M. J.
Hobart
,
A.
Orren
.
1998
.
Reference typing report for complement components C6, C7 and C9 including mutations leading to deficiencies.
Exp. Clin. Immunogenet.
15
:
268
285
.
16.
Haefliger
J. A.
,
J.
Tschopp
,
N.
Vial
,
D. E.
Jenne
.
1989
.
Complete primary structure and functional characterization of the sixth component of the human complement system. Identification of the C5b-binding domain in complement C6.
J. Biol. Chem.
264
:
18041
18051
.
17.
Church
D. M.
,
V. A.
Schneider
,
T.
Graves
,
K.
Auger
,
F.
Cunningham
,
N.
Bouk
,
H. C.
Chen
,
R.
Agarwala
,
W. M.
McLaren
,
G. R.
Ritchie
, et al
2011
.
Modernizing reference genome assemblies.
PLoS Biol.
9
:
e1001091
.
18.
DiScipio
R. G.
,
T. E.
Hugli
.
1989
.
The molecular architecture of human complement component C6.
J. Biol. Chem.
264
:
16197
16206
.
19.
Hobart
M. J.
,
B.
Fernie
,
R. G.
DiScipio
.
1993
.
Structure of the human C6 gene.
Biochemistry
32
:
6198
6205
.
20.
Aleshin
A. E.
,
R. G.
DiScipio
,
B.
Stec
,
R. C.
Liddington
.
2012
.
Crystal structure of C5b-6 suggests structural basis for priming assembly of the membrane attack complex.
J. Biol. Chem.
287
:
19642
19652
.
21.
Hobart
M. J.
,
P. J.
Lachmann
,
R. Y.
Calne
.
1977
.
C6: synthesis by the liver in vivo.
J. Exp. Med.
146
:
629
630
.
22.
Hetland
G.
,
E.
Johnson
,
R. J.
Falk
,
T.
Eskeland
.
1986
.
Synthesis of complement components C5, C6, C7, C8 and C9 in vitro by human monocytes and assembly of the terminal complement complex.
Scand. J. Immunol.
24
:
421
428
.
23.
Garred
P.
,
G.
Hetland
,
T. E.
Mollnes
,
G.
Stoervold
.
1990
.
Synthesis of C3, C5, C6, C7, C8, and C9 by human fibroblasts.
Scand. J. Immunol.
32
:
555
560
.
24.
Johnson
E.
,
G.
Hetland
.
1991
.
Human umbilical vein endothelial cells synthesize functional C3, C5, C6, C8 and C9 in vitro.
Scand. J. Immunol.
33
:
667
671
.
25.
Gasque
P.
,
M.
Fontaine
,
B. P.
Morgan
.
1995
.
Complement expression in human brain. Biosynthesis of terminal pathway components and regulators in human glial cells and cell lines.
J. Immunol.
154
:
4726
4733
.
26.
Terai
K.
,
D. G.
Walker
,
E. G.
McGeer
,
P. L.
McGeer
.
1997
.
Neurons express proteins of the classical complement pathway in Alzheimer disease.
Brain Res.
769
:
385
390
.
27.
GTEx Consortium
.
2020
.
The GTEx Consortium atlas of genetic regulatory effects across human tissues.
Science
369
:
1318
1330
.
28.
DiScipio
R. G.
,
D. N.
Chakravarti
,
H. J.
Muller-Eberhard
,
G. H.
Fey
.
1988
.
The structure of human complement component C7 and the C5b-7 complex.
J. Biol. Chem.
263
:
549
560
.
29.
Hobart
M. J.
,
B. A.
Fernie
,
R. G.
DiScipio
.
1995
.
Structure of the human C7 gene and comparison with the C6, C8A, C8B, and C9 genes.
J. Immunol.
154
:
5188
5194
.
30.
Serna
M.
,
J. L.
Giles
,
B. P.
Morgan
,
D.
Bubeck
.
2016
.
Structural basis of complement membrane attack complex formation.
Nat. Commun.
7
:
10587
.
31.
Würzner
R.
,
V. C.
Joysey
,
P. J.
Lachmann
.
1994
.
Complement component C7. Assessment of in vivo synthesis after liver transplantation reveals that hepatocytes do not synthesize the majority of human C7.
J. Immunol.
152
:
4624
4629
.
32.
Würzner
R.
2000
.
Modulation of complement membrane attack by local C7 synthesis.
Clin. Exp. Immunol.
121
:
8
10
.
33.
Hobart
M. J.
,
B. A.
Fernie
,
K. A.
Fijen
,
A.
Orren
.
1998
.
The molecular basis of C6 deficiency in the western Cape, South Africa.
Hum. Genet.
103
:
506
512
.
34.
Fernie
B. A.
,
A.
Orren
,
G.
Sheehan
,
M.
Schlesinger
,
M. J.
Hobart
.
1997
.
Molecular bases of C7 deficiency: three different defects.
J. Immunol.
159
:
1019
1026
.
35.
National Center for Biotechnology Information
.
2021
.
Homo sapiens complement C6 (C6), RefSeqGene (LRG_29) on chromosome 5.
.
36.
National Center for Biotechnology Information
.
2021
.
Homo sapiens complement C7 (C7), RefSeqGene (LRG_30) on chromosome 5.
.
37.
Sharp
P. A.
2005
.
The discovery of split genes and RNA splicing.
Trends Biochem. Sci.
30
:
279
281
.
38.
Wang
Y.
,
J.
Liu
,
B. O.
Huang
,
Y.-M.
Xu
,
J.
Li
,
L.-F.
Huang
,
J.
Lin
,
J.
Zhang
,
Q.-H.
Min
,
W.-M.
Yang
,
X.-Z.
Wang
.
2015
.
Mechanism of alternative splicing and its regulation.
Biomed. Rep.
3
:
152
158
.
39.
Zheng
C. L.
,
X.-D.
Fu
,
M.
Gribskov
.
2005
.
Characteristics and regulatory elements defining constitutive splicing and different modes of alternative splicing in human and mouse.
RNA
11
:
1777
1787
.
40.
Kaessmann
H.
,
S.
Zöllner
,
A.
Nekrutenko
,
W.-H.
Li
.
2002
.
Signatures of domain shuffling in the human genome.
Genome Res.
12
:
1642
1650
.
41.
Schad
E.
,
L.
Kalmar
,
P.
Tompa
.
2013
.
Exon-phase symmetry and intrinsic structural disorder promote modular evolution in the human genome.
Nucleic Acids Res.
41
:
4409
4422
.
42.
Zheng
J.-T.
,
C.-X.
Lin
,
Z.-Y.
Fang
,
H.-D.
Li
.
2020
.
Intron retention as a mode for RNA-seq data analysis.
Front. Genet.
11
:
586
.
43.
Monteuuis
G.
,
J. J. L.
Wong
,
C. G.
Bailey
,
U.
Schmitz
,
J. E. J.
Rasko
.
2019
.
The changing paradigm of intron retention: regulation, ramifications and recipes.
Nucleic Acids Res.
47
:
11497
11513
.
44.
Nguyen
H. D.
,
M.
Yoshihama
,
N.
Kenmochi
.
2006
.
Phase distribution of spliceosomal introns: implications for intron origin.
BMC Evol. Biol.
6
:
69
.
45.
Bingham
P. M.
,
T.-B.
Chou
,
I.
Mims
,
Z.
Zachar
.
1988
.
On/off regulation of gene expression at the level of splicing.
Trends Genet.
4
:
134
138
.
46.
Patthy
L.
1999
.
Genome evolution and the evolution of exon-shuffling—a review.
Gene
238
:
103
114
.
47.
Kienzle
N.
,
D. B.
Young
,
D.
Liaskou
,
M.
Buck
,
S.
Greco
,
T. B.
Sculley
.
1999
.
Intron retention may regulate expression of Epstein-Barr virus nuclear antigen 3 family genes.
J. Virol.
73
:
1195
1204
.
48.
Resch
A.
,
Y.
Xing
,
A.
Alekseyenko
,
B.
Modrek
,
C.
Lee
.
2004
.
Evidence for a subpopulation of conserved alternative splicing events under selection pressure for protein reading frame preservation.
Nucleic Acids Res.
32
:
1261
1269
.
49.
Sun
B. B.
,
J. C.
Maranville
,
J. E.
Peters
,
D.
Stacey
,
J. R.
Staley
,
J.
Blackshaw
,
S.
Burgess
,
T.
Jiang
,
E.
Paige
,
P.
Surendran
, et al
2018
.
Genomic atlas of the human plasma proteome.
Nature
558
:
73
79
.
50.
Nishizaka
H.
,
T.
Horiuchi
,
Z. B.
Zhu
,
Y.
Fukumori
,
K.
Nagasawa
,
K.
Hayashi
,
R.
Krumdieck
,
C. G.
Cobbs
,
M.
Higuchi
,
S.
Yasunaga
, et al
1996
.
Molecular bases for inherited human complement component C6 deficiency in two unrelated individuals.
J. Immunol.
156
:
2309
2315
.
51.
Dewald
G.
,
M. M.
Nöthen
,
S.
Cichon
.
1993
.
Polymorphism of human complement component C6: an amino acid substitution (Glu/Ala) within the second thrombospondin repeat differentiates between the two common allotypes C6 A and C6 B.
Biochem. Biophys. Res. Commun.
194
:
458
464
.
52.
Fernie
B. A.
,
R.
Würzner
,
A.
Orren
,
B. P.
Morgan
,
P. C.
Potter
,
A. E.
Platonov
,
I. V.
Vershinina
,
G. A.
Shipulin
,
P. J.
Lachmann
,
M. J.
Hobart
.
1996
.
Molecular bases of combined subtotal deficiencies of C6 and C7: their effects in combination with other C6 and C7 deficiencies.
J. Immunol.
157
:
3648
3657
.
53.
Morgan
B. P.
,
J. P.
Vora
,
A. J.
Bennett
,
J. P.
Thomas
,
N.
Matthews
.
1989
.
A case of hereditary combined deficiency of complement components C6 and C7 in man.
Clin. Exp. Immunol.
75
:
396
401
.
54.
Lachmann
P. J.
,
M. J.
Hobart
,
P.
Woo
.
1978
.
Combined genetic deficiency of C6 and C7 in man.
Clin. Exp. Immunol.
33
:
193
203
.
55.
Würzner
R.
,
B. A.
Fernie
,
A. M.
Jones
,
P. J.
Lachmann
,
M. J.
Hobart
.
1995
.
Molecular basis of the complement C7 M/N polymorphism. A neutral amino acid substitution outside the epitope of the allospecific monoclonal antibody WU 4-15.
J. Immunol.
154
:
4813
4819
.
56.
Würzner
R.
,
K.
Tokunaga
,
R.
Nitze
,
O.
Götze
,
P. J.
Lachmann
.
1991
.
C7*N is a hypomorphic allele of the human complement c7 M/N protein polymorphism.
Exp. Clin. Immunogenet.
8
:
177
183
.
57.
Würzner
R.
,
A.
Orren
,
P.
Potter
,
B. P.
Morgan
,
D.
Ponard
,
P.
Späth
,
M.
Brai
,
M.
Schulze
,
L.
Happe
,
O.
Götze
.
1991
.
Functionally active complement proteins C6 and C7 detected in C6- and C7-deficient individuals.
Clin. Exp. Immunol.
83
:
430
437
.
58.
Würzner
R.
,
B. M.
Sölder
,
W. M.
Prodinger
,
M. P.
Dierich
.
1995
.
Complement C7 M/N allotyping in infectious diseases.
Exp. Clin. Immunogenet.
12
:
61
65
.
59.
Fernie
B. A.
,
M. J.
Hobart
.
1998
.
Complement C7 deficiency: seven further molecular defects and their associated marker haplotypes.
Hum. Genet.
103
:
513
519
.
60.
El Sissy
C.
,
J.
Rosain
,
P.
Vieira-Martins
,
P.
Bordereau
,
A.
Gruber
,
M.
Devriese
,
L.
de Pontual
,
M.-K.
Taha
,
C.
Fieschi
,
C.
Picard
,
V.
Frémeaux-Bacchi
.
2019
.
Clinical and genetic spectrum of a large cohort with total and sub-total complement deficiencies.
Front. Immunol.
10
:
1936
.
61.
Zhu
Z.
,
T. P.
Atkinson
,
K. T.
Hovanky
,
S. B.
Boppana
,
Y. L.
Dai
,
P.
Densen
,
R. C.
Go
,
J. S.
Jablecki
,
J. E.
Volanakis
.
2000
.
High prevalence of complement component C6 deficiency among African-Americans in the south-eastern USA.
Clin. Exp. Immunol.
119
:
305
310
.
62.
Dragon-Durey
M. A.
,
V.
Fremeaux-Bacchi
,
J.
Blouin
,
D.
Barraud
,
W. H.
Fridman
,
M. D.
Kazatchkine
.
2003
.
Restricted genetic defects underlie human complement C6 deficiency.
Clin. Exp. Immunol.
132
:
87
91
.
63.
Parham
K. L.
,
A.
Roberts
,
A.
Thomas
,
R.
Würzner
,
H. E.
Henderson
,
P. C.
Potter
,
B. P.
Morgan
,
A.
Orren
.
2007
.
Prevalence of mutations leading to complete C6 deficiency (C6Q0) in the Western Cape, South Africa and detection of novel mutations leading to C6Q0 in an Irish family.
Mol. Immunol.
44
:
2756
2760
.
64.
Moya-Quiles
M. R.
,
M. V.
Bernardo-Pisa
,
P.
Martínez
,
L.
Gimeno
,
A.
Bosch
,
G.
Salgado
,
H.
Martínez-Banaclocha
,
J.
Eguia
,
J. A.
Campillo
,
M.
Muro
, et al
2013
.
Complement component C6 deficiency in a Spanish family: implications for clinical and molecular diagnosis.
Gene
521
:
204
206
.
65.
Zhu
Z.-B.
,
K.
Totemchokchyakarn
,
T. P.
Atkinson
,
J. E.
Volanakis
.
1998
.
Molecular defects leading to human complement component C6 deficiency in an African-American family.
Clin. Exp. Immunol.
111
:
91
96
.
66.
Delbridge
G. J.
1994
.
Molecular analysis of the complement component six gene.
Ph.D. thesis
,
The Australian National University
,
Canberra, ACT, Australia
.
67.
Westra
D.
,
R. A. J.
Kurvers
,
L. P.
van den Heuvel
,
R.
Würzner
,
E. P. A. H.
Hoppenreijs
,
M.
van der Flier
,
N. C. A. J.
van de Kar
,
A.
Warris
.
2014
.
Compound heterozygous mutations in the C6 gene of a child with recurrent infections.
Mol. Immunol.
58
:
201
205
.
68.
Fernie
B. A.
,
M. J.
Hobart
.
1997
.
An unusual combined insertion/deletion polymorphism in intron 10 of the human complement C6 gene.
Hum. Genet.
100
:
104
108
.
69.
Barroso
S.
,
M.
López-Trascasa
,
D.
Merino
,
A. J.
Alvarez
,
A.
Núñez-Roldán
,
B.
Sánchez
.
2010
.
C7 deficiency and meningococcal infection susceptibility in two spanish families.
Scand. J. Immunol.
72
:
38
43
.
70.
Barroso
S.
,
C.
Rieubland
,
A.
José álvarez
,
M.
López-Trascasa
,
P.-A.
Bart
,
A.
Núñez-Roldán
,
B.
Sánchez
.
2006
.
Molecular defects of the C7 gene in two patients with complement C7 deficiency.
Immunology
118
:
257
260
.
71.
O’Hara
A. M.
,
B. A.
Fernie
,
A. P.
Moran
,
Y. E.
Williams
,
J. J.
Connaughton
,
A.
Orren
,
M. J.
Hobart
.
1998
.
C7 deficiency in an Irish family: a deletion defect which is predominant in the Irish.
Clin. Exp. Immunol.
114
:
355
361
.
72.
Fernie
B. A.
,
R.
Würzner
,
D. J.
Unsworth
,
R. I.
Tuxworth
,
M. J.
Hobart
.
1995
.
DNA polymorphisms of the complement C6 and C7 genes.
Ann. Hum. Genet.
59
:
163
181
.
73.
Dewald
G.
,
M. M.
Nöthen
,
K.
Rüther
.
1994
.
A common Ser/Thr polymorphism in the perforin-homologous region of human complement component C7.
Hum. Hered.
44
:
301
304
.
74.
He
J.
,
J.
Fu
,
D.
Fan
.
2021
.
The complement C7 variant rs3792646 is associated with amyotrophic lateral sclerosis in a Han Chinese population.
Neurobiol. Aging
99
:
103.e1
103.e7
.
75.
Barroso
S.
,
B.
Sánchez
,
A. J.
Alvarez
,
M.
López-Trascasa
,
A.
Lanuza
,
R.
Luque
,
I.
Wichmann
,
A.
Núñez-Roldán
.
2004
.
Complement component C7 deficiency in two Spanish families.
Immunology
113
:
518
523
.
76.
Kang
H. J.
,
C.-S.
Ki
,
Y.-S.
Kim
,
M.
Hur
,
S. I.
Jang
,
K. S.
Min
.
2006
.
Two mutations of the C7 gene, c.1424G > A and c.281-1G > T, in two Korean families.
J. Clin. Immunol.
26
:
186
191
.
77.
Fernie
B. A.
,
A.
Orren
,
M.
Schlesinger
,
R.
Würzner
,
A. E.
Platonov
,
R. C.
Cooper
,
Y. E.
Williams
,
M. J.
Hobart
.
1997
.
DNA haplotypes of the complement C6 and C7 genes associated with deficiencies of the seventh component; and a new DNA polymorphism in C7 exon 13.
Ann. Hum. Genet.
61
:
287
298
.
78.
Horiuchi
T.
,
J. M.
Ferrer
,
P.
Serra
,
N.
Matamoros
,
M.
López-Trascasa
,
C.
Hashimura
,
Y.
Niho
.
1999
.
A novel nonsense mutation at Glu-631 in a Spanish family with complement component 7 deficiency.
J. Hum. Genet.
44
:
215
218
.
79.
Nishizaka
H.
,
T.
Horiuchi
,
Z. B.
Zhu
,
Y.
Fukumori
,
J. E.
Volanakis
.
1996
.
Genetic bases of human complement C7 deficiency.
J. Immunol.
157
:
4239
4243
.
80.
Ki
C.-S.
,
J.-W.
Kim
,
H.-J.
Kim
,
S.-M.
Choi
,
G.-Y.
Ha
,
H. J.
Kang
,
W.-D.
Kim
.
2005
.
Two novel mutations in the C7 gene in a Korean patient with complement C7 deficiency.
J. Korean Med. Sci.
20
:
220
224
.
81.
Fernie
B. A.
,
R.
Würzner
,
A.
Orren
,
M.
Hobart
.
1996
.
A new intronic polymorphism in the C7 gene 36 bp from the common expressed C7 M/N polymorphism.
Ann. Hum. Genet.
60
:
179
182
.

The authors have no financial conflicts of interest.

This article is distributed under the terms of the CC BY 4.0 Unported license.