Foot-and-mouth disease virus (FMDV) is the causative agent of foot-and-mouth disease, one of the most highly infectious animal viruses throughout the world. The JAK-STAT signaling pathway is a highly conserved pathway for IFN-β–induced antiviral gene expression. Previous studies have shown that FMDV can strongly suppress the innate immune response. Moreover, although STAT1 and STAT2 (STAT1/2) have been well established in JAK-STAT signaling–induced antiviral gene expression, whether FMDV proteins inhibit IFN-β–induced JAK-STAT signaling remains poorly understood. In this study, we described the Lb leader protease (Lbpro) of FMDV as a candidate for inhibiting IFN-β–induced signaling transduction via directly interacting with STAT1/2. We further showed that Lbpro colocalized with STAT1/2 to inhibit their nuclear translocation. Importantly, Lbpro cleaved STAT1/2 to inhibit IFN-β–induced signal transduction, whereas the catalytically inactive mutant of LC51A (Lbpro with cysteine substituted with alanine at amino acid residue 51) had no effect on the stability of STAT1/2 proteins. The cleavage of the STAT1/2 proteins was also determined during FMDV infection in vitro. Lbpro could cleave the residues between 252 and 502 aa for STAT1 and the site spanning residues 140 − 150 aa (QQHEIESRIL) for STAT2. The in vivo results showed that Lbpro can cleave STAT1/2 in pigs. Overall, our findings suggest that FMDV Lbpro–mediated targeting of STAT1/2 may reveal a novel mechanism for viral immune evasion.

Visual Abstract

The antiviral innate immune response, largely dependent on IFN-stimulated gene (ISG) transcription, induced JAK-STAT signaling pathway activation through IFN production. Secreted IFN proteins play a critical role in both host antiviral innate and adaptive immunity (15). To date, three types of IFNs have been identified to constitute the whole IFN family (611), of which type I IFN (IFN-α/β) is the most widely deployed to mediate the host defense responses through JAK-STAT signaling transduction. IFN-α and IFN-β interact with their cognate receptors, IFNARs, inducing the activation of JAK1 and tyrosine kinase 2 (Tyk2), which lead to STAT1/2 phosphorylation. The phosphorylated STAT1-STAT2 dimer can then translocate into the nucleus and interact with IFN regulatory factor (IRF)9, which forms an ISG factor 3 (ISGF3) complex. Similar to other transcription factors, ISGF3 binds to the promoter of IFN-sensitive response element (STAT1/2 binding promoter), which results in the expression of a large number of antiviral ISGs (12, 13).

To counter antiviral ISG expression, viruses have evolved numerous elegant strategies to disrupt signaling of the JAK-STAT pathway. For instance, Japanese encephalitis virus NS5 has been demonstrated to block Tyk2 phosphorylation to hinder JAK-STAT signal transduction (14), whereas respirovirus C protein inhibits JAK1 and Tyk2 activation to antagonize ISG expression (15). Moreover, enterovirus 71 infection blocks JAK-STAT signaling through downregulating the nuclear localization signal receptor karyopherin α1 (KPNA1) of p-STAT1. Although this effect is not mediated via the 2A and 3C proteases of enterovirus 71, the underlying mechanism remains elusive (16).

FMDV is the causative agent of foot-and-mouth disease, which belongs to the Aphthovirus genus of the Picornaviridae family and is one of the most highly infectious animal viruses in the world. FMDV contains a positive-stranded RNA genome, which encodes four structural proteins (VP1, VP2, VP3, and VP4) and eight nonstructural proteins (leader protease [Lpro], 2A, 2B, 2C, 3A, 3B, 3C, and 3D). The FMDV enzyme proteins have been demonstrated to be crucial for immune regulation and FMDV replication (e.g., FMDV 3Cpro targeted and cleaved NF-κB essential modulator [NEMO] at the Gln383 residue to inhibit innate immune signaling [17]). In particular, FMDV 3Cpro blocks STAT1/2 nuclear translocation to antagonize the IFN signaling pathway (18), 3D is a polymerase used to catalyze FMDV replication (19), and Lpro cleaves the polyprotein of FMDV (20, 21). The L gene, located at the N terminus of the FMDV genome, is translated in two protein forms, termed Lab protein and Lb protein (Lb leader protease [Lbpro]). The N termini of the two proteins differ since viral protein synthesis begins at two different initiation sites, separated by 84 nt. The Lb protein (Lbpro) is more favorably synthetized than the Lab protein (22). In addition, Lbpro functions as a papain-like cysteine proteinase (23, 24) and targets the host proteins (2532) to play an essential role in viral replication and immunosuppression. To date, the Lbpro of FMDV has been shown to be crucial for immune regulation by cleaving the essential components of the critical signal transduction pathway; however, this mechanism has only been investigated upstream of IFN-β production (30, 33, 34). For instance, Lpro decreases the level of IRF3 and IRF7 proteins to inhibit dsRNA-induced type I IFN (IFN-I) production (34). Moreover, Lpro also interacts with activity-dependent neuroprotective protein to decrease the expression of IFN-β and ISGs (32). Although previous studies have shown that the FMDV 3C protein specifically induces KPNA1 degradation to block STAT1/2 nuclear translocation (18), the effect of Lbpro of FMDV on the IFN-β–induced JAK-STAT signaling transduction at the mechanistic level remains unclear.

To elucidate whether FMDV may have evolved diverse functions to evade IFN-β–induced JAK-STAT signaling, we found that FMDV Lbpro targeted STAT1/2 to hinder JAK-STAT signaling transduction, as well as STAT1/2 translocation. In this study, we demonstrate that Lbpro decreased the level of STAT1/2 protein expression to inhibit IFN-β–induced JAK-STAT signaling. Lbpro was found to use its protease activity to cleave STAT1/2. STAT1 and STAT2 protein cleavage was also demonstrated during FMDV infection both in vitro and in vivo. Infection with the rFMDV Lb gene knockout (LbKO) attenuated the reduction in the level of the STAT1 and STAT2 proteins. This study uncovered a new mechanism through which FMDV Lbpro can antagonize IFN-β–induced JAK-STAT–mediated antiviral immune responses.

Baby hamster kidney 21 (BHK21) cells and porcine kidney 15 (PK15) cells were cultured in MEM (Life Technologies). Human embryonic kidney 293 (HEK293) cells were cultured in DMEM (Life Technologies) and then supplemented with 10% FBS, 100 U/ml penicillin, and 100 μg/ml streptomycin at 37°C with 5% CO2. These cells are all maintained in our laboratory. The FMDV (FMDV/O/BY/CHA/2010) Lb knockout recombinant mutant was constructed in our laboratory. Wild-type (WT) FMDV (FMDV/O/BY/CHA/2010), vesicular stomatitis virus (VSV) with a GFP tag (VSV-GFP), and Sendai virus were maintained in our laboratory. Replication and titration of FMDV were performed on BHK21 cells. Abs against hemagglutinin (HA) (catalog no. H3663), myc (catalog no. M4439), STAT1 (catalog no. HPA000982), STAT2 (SAB1404413), and Flag (catalog no. F1804) were purchased from Sigma-Aldrich (St. Louis, MO). Abs of STAT2 (catalog no. 72640), β-actin (catalog no. 3700), HSP90 (catalog no. 4877), p-STAT1 (catalog no. 8826), p-STAT2 (catalog no. 88410), and lamin B1 (catalog no. 17416) were obtained from Cell Signaling Technology (Danvers, MA). TRIzol was purchased from Invitrogen (Thermo Fisher Scientific, Waltham, MA). Lipofectamine 2000 was purchased from InvivoGen (San Diego, CA).

Lb gene cDNA was amplified from the total RNA extract from FMDV/O/BY/CHA/2010 and L gene as a template for LC51A (Lbpro with cysteine substituted with alanine at amino acid residue 51) gene construction. DNA fragments of STAT1 or STAT2 were generated by corresponding PCR amplification from total RNA of HEK293 or PK15 cells. Mutant expression plasmids were constructed by cloning the indicated sequences into pcDNA3.1(+) or pCAGGS (our laboratory collection). Using Lipofectamine 2000 (Invitrogen) for transfection, STAT1/2 plasmids and Lbpro were cotransfected into the indicated cell lines.

We successfully constructed rFMDV using the reverse genetic system established in our laboratory, with the deletion of the Lb gene of the FMDV/O/BY/CHA/2010 strain. The resultant rFMDV lacks the Lb coding region while containing the entire structural proteins. The engineered plasmids were transfected into BHK21 cells, and rFMDV LKO was obtained after 48–60 h.

MAVS−/−, IRF3−/−, STAT1−/−, and STAT2−/− knockout cells were constructed using the CRISPR/Cas9 technique. The single-guide RNA sequences were as follows: MAVS−/−, 5′-TCCGCCGAAGGCTGTCGAAG-3′; IRF3−/−, 5′-GTGTGGCGGACTACGTGCGC-3′; STAT1−/−, 5′-AAGGGGCCATCACGTTCACG-3′; STAT2−/−, 5′-GGGCAGCAATAGCTCGATTA-3′. The single-guide RNA was inserted into the lentiviral plasmid pHBLV-U6-gRNA-EF1-CAS9-PURO (purchased from Hanbio Biotechnology, Shanghai, China), which contained Cas9, and the lentivirus was packaged to infect PK15 cells. After puromycin screening, the positive cells were sequenced and verified by Western blotting detection.

STAT1/2 (100 ng/well) binding promoter-luc along with various plasmids encoding the indicated target genes, an empty vector (EV), or pRL-TK plasmid (for normalization of transfection efficiency) was cotransfected into HEK293 cells (1 × 105/well). IFN-β was further stimulated or unstimulated with cells at 24 h posttransfection, harvested after 6 or 12 h, and the Dual-Luciferase reporter assay system (Promega) was used to determine both Renilla luciferase and firefly luciferase activities.

RNA was collected from whole cells pretreated with various stimuli using an RNA extraction kit (Promega). RNA was reverse transcribed into cDNA using the Moloney murine leukemia virus reverse transcription system (Promega). Gene RNA expression was determined by SYBR Green real-time PCR or absolute quantification module using the Bio-Rad CFX Connect system. Data of quantitative PCR (qPCR) were normalized to the expression of GAPDH. Real-time qPCR primers are listed in Table I.

Table I.

Primers for qPCR

Primers for Real-Time PCRSequence (5′→3′)
pISG15-F CCTGTTGATGGTGCAAAGCT 
pISG15-R TGCACATAGGCTTGAGGTCA 
pISG54-F CTGGCAAAGAGCCCTAAGGA 
pISG54-R CTCAGAGGGTCAATGGAATTCC 
pOAS1-F AAGCATCAGAAGCTTTGCATCTT 
pOAS1-R CAGGCCTGGGTTTCTTGAGTT 
pGAPDH-F ACATGGCCTCCAAGGAGTAAGA 
pGAPDH-R GATCGAGTTGGGGCTGTGACT 
pSTAT2-F TGGATGGAGAGTTGGAGCAG 
pSTAT2-R CTTGCTCCCAGTCTTGAGGA 
pSTAT1-F CTAGTGGAGTGGAAGCGGAG 
pSTAT1-R CACCACAAACGAGCTCTGAA 
FMDV-F ACTGGGTTTTACAAACCTGTGA 
FMDV-R GCGAGTCCTGCCACGGA 
F-Lb-F TGAACGCCATCCTCCAGTT 
F-Lb-R CATCCACCATGCACACCTC 
Primers for Real-Time PCRSequence (5′→3′)
pISG15-F CCTGTTGATGGTGCAAAGCT 
pISG15-R TGCACATAGGCTTGAGGTCA 
pISG54-F CTGGCAAAGAGCCCTAAGGA 
pISG54-R CTCAGAGGGTCAATGGAATTCC 
pOAS1-F AAGCATCAGAAGCTTTGCATCTT 
pOAS1-R CAGGCCTGGGTTTCTTGAGTT 
pGAPDH-F ACATGGCCTCCAAGGAGTAAGA 
pGAPDH-R GATCGAGTTGGGGCTGTGACT 
pSTAT2-F TGGATGGAGAGTTGGAGCAG 
pSTAT2-R CTTGCTCCCAGTCTTGAGGA 
pSTAT1-F CTAGTGGAGTGGAAGCGGAG 
pSTAT1-R CACCACAAACGAGCTCTGAA 
FMDV-F ACTGGGTTTTACAAACCTGTGA 
FMDV-R GCGAGTCCTGCCACGGA 
F-Lb-F TGAACGCCATCCTCCAGTT 
F-Lb-R CATCCACCATGCACACCTC 

F, forward; p, porcine; R, reverse.

The indicated plasmids were transiently expressed into HEK293 cells for 24 h. Then cells were harvested after IFN-β stimulation with or without virus infection and lysed with lysis buffer containing complete protease inhibitor mixture (Roche). Whole-cell lysates were sonicated at 4°C and cleared by centrifugation. For immunoprecipitation, the supernatant was collected and incubated with the specific Abs overnight at 4°C, and then the mixed supernatant was incubated with protein A+G–agarose (Roche) for 2 h at 4°C. The Sepharose beads were washed five times with 1 ml of lysis buffer, with centrifugation at 13,800 × g for 30 s. The resulting immunoprecipitates were resolved by 6–18% SDS-PAGE. Proteins were transferred from SDS-PAGE gel onto a polyvinylidene difluoride membrane (Millipore). The membranes were incubated with the indicated primary Abs after blocking with 5% nonfat milk in 0.05% Tween 20 with TBS, followed by HRP-labeled secondary Abs. The membrane was detected by an ECL substrate (Western Lightning Plus chemiluminescent substrate kit, PerkinElmer), and a protein imaging system (ChemiDoc XRS+, Bio-Rad) was used for the visualization.

Recombinant VSV-GFP was used to evaluate antiviral responses. Briefly, the indicated plasmids were expressed in HEK293 cells for 24 h and pretreated with IFN-β for 6 or 12 h. The cells were washed three times with Opti-MEM medium, and the recombinant VSV-GFP (multiplicity of infection [MOI] of 1) was permitted to infect the cells for 1 h at 37°C, then maintained in DMEM medium without FBS. After 10 h postinfection (hpi), HEK293 cells were observed by fluorescence microscopy and VSV-GFP titer was determined.

The indicated plasmids were transfected into PK15 cells for 24 h and pretreated with IFN-β for 6 h. Then cells were washed three times with Opti-MEM medium, and FMDV LbWT or FMDV LbKO (MOI of 1) was permitted to infect the cells for 1 h at 37°C, then maintained in MEM medium. After 12 h postinfection (hpi), the viruses were collected after freeze-thawing three times. Furthermore, BHK21 cells were cultured in a 96-well plate to produce cell monolayers after 24 h. The cells were infected by incubation with serial 10-fold dilutions (made in MEM without FBS) of FMDV LbWT or FMDV LbKO virus for 1 h at 37°C. After the indicated infection period, the virus cytopathic effect (CPE) was observed under an inverted microscope, and virus titer was determined.

PK15 cells were cultured in 60-mm plastic dishes and maintained in MEM medium containing 10% FBS. The cells were treated with IFN-β or left untreated for 6 h after EV or Lbpro transfection for 24 h. The cells were then infected with FMDV (MOI of 1) or left uninfected for 1 h. After 12 h, FMDV was collected. The PK15 cells were cultured in 12-well plates, and the collected FMDV was serially diluted by a 10-fold gradient and added to the 12-well plates in an equal volume. After 1 h, the cells were washed three times with ice-cold PBS and then cultured with a medium containing 1.5% methylcellulose for 3–5 d. After crystal violet staining, statistical analysis was performed.

The indicated plasmids were expressed in PK15 or HEK293 cells; after 24 h, the cells were washed with cold PBS three times. Subsequently, the cells were fixed with 4% paraformaldehyde solution for 30 min at room temperature and then washed again with PBS three times and permeabilized in 1% Triton X-100/PBS containing 10% sheep serum for 20 min at room temperature. Cells were then washed with PBS three times. After that, cells for nonspecific binding were blocked in 5% BSA and 0.1% Tween 20 in PBS for 1 h, gently washed three times with ice-cold PBS for 5 min, and then incubated overnight at 4°C with specific primary Abs, followed by fluorescence-labeled secondary Ab incubation for 1 h. Subsequently, cell nuclei were stained with DAPI (Sigma-Aldrich). A Zeiss LSM 710 confocal microscope was used for image acquisition.

Animal experiments with viral infection were carried out in the biosafety level 3 bio-containment facility of Lanzhou Veterinary Research Institution of the Chinese Academy of Agricultural Sciences, following the guidelines approved by the Lanzhou Veterinary Research Institution Animal Ethics Committee.

WT (type O) FMDV, its mutant LbKO, or MEM medium was used to inoculate pigs. Forty-two pigs (20–30 kg of 2-mo-old piglets) were randomly assigned to three groups, with five animals each for the FMDV WT and LbKO groups, and five for the control group. Pigs were inoculated via i.m. injection in the neck with 3 × 1011 copy numbers/animal. Clinical signs, such as rectal temperatures, vesicular lesions of the mouth, and lesions of the foot bearing, were observed daily.

Samples were collected at 1, 2, 3, 5, and 10 d postinfection (dpi). The fresh spleen and lymph node were collected, snap-frozen with liquid nitrogen, and kept at −80°C for subsequent Western blotting and RNA expression determination.

The tested serum was diluted from 1:4 to 512. The dilution method used for the positive or negative controls was the same as the test samples. The diluted serum in 50 μl was added to the ELISA microplate followed by 50 μl of enzyme Ab to each well and mixed. The plate was covered and incubated for 30 min at 37°C. The plate was washed five times and 50 μl of substrate was distributed to each well. The plate was covered and left for 10–15 min at 37°C in the dark. Finally, 50 μl of stop solution was added to each well. The absorbance at 450 nm for each well was measured with a microplate reader (FLUOstar OPTIMA, BMG Labtech, Ortenberg, Germany).

Sample serum and MEM were inactivated at 56°C for 30 min after mixing. The samples, as well as positive and negative serum, were serially diluted from 1:4 to 512. The virus titer was then diluted to a 50% tissue culture infective dose of 200. The diluted-serum was mixed with virus and incubated for 1 h at 37°C. After that, the mixture was added to BHK21 cells, which were cultured in a 96-well plate for 24 h. The cells were incubated in a 37°C incubator and observed once on the third day. The cells were monitored for the appearance of CPEs by light microscopy on the fourth or fifth day. The neutralizing Ab titers were assessed.

Each independent experiment was performed in triplicate and subjected to two-way ANOVA or a Student t test using GraphPad Prism 8 (GraphPad Software, San Diego, CA). A p value of <0.05 was considered statistically significant.

To explore whether FMDV affected the IFN-β–induced signal transduction blockade, PK15 cells were first infected with FMDV followed by the addition of porcine IFN-β, which can induce ISGF3 binding promoter (STAT1/2-luc) activity and consequently trigger antiviral gene (e.g., ISGs) expression. The luciferase reporter assays showed that FMDV infection inhibited IFN-β–induced STAT1/2-luc activity (Fig. 1A). Next, we investigated whether Lbpro, 3C, or 3D influenced IFN-β–induced STAT1/2-luc activity. We found that both 3C and Lbpro inhibited STAT1/2 binding promoter activities, which were enhanced by 3D (Fig. 1B). Consistent with the findings of a previous study, the FMDV 3C protein inhibited JAK-STAT signaling (18). Therefore, we narrowed down Lbpro as the candidate to inhibit STAT1/2 binding promoter activity. Furthermore, we found that Lbpro suppressed IFN-β–induced STAT1/2 binding promoter activation in a dose-dependent manner (Fig. 1C). This observation prompted us to determine whether Lbpro could impact IFN-β–induced antiviral activity and thus facilitate viral replication using a FMDV or VSV-GFP infection assay. The virus plaque, titer, and CPE data demonstrated that Lbpro facilitated FMDV replication following IFN-β treatment comparing with control (EV) (Fig. 1D, 1E). Consistently, virus GFP fluorescence intensity and VSV-GFP titer results in (Fig. 1F showed that Lbpro increased the replication of VSV-GFP during IFN-β stimulation as compared with EV. Next, we assessed the IFN-β–induced expression of ISGs after L gene transfection. The data revealed that Lbpro could significantly inhibit transcription of the antiviral genes ISG20, ISG54, and ISG56 (Fig. 1G).

FIGURE 1.

FMDV Lbpro blocks IFN-β–induced signaling transduction and inhibits its activation. (A) Plasmids of the STAT1/2 binding promoter-Luc and pRL-TK were transfected into PK15 cells. After 24 h, the cells were infected with FMDV or left uninfected for 8 h. Next, the cells were either stimulated with IFN-β or left unstimulated for 6 h. Finally, the cells were collected and lysed for a luciferase assay. (B) Plasmids expressing the STAT1/2 binding promoter-Luc and pRL-TK with plasmids 3C, Lb, 3D, or an empty vector (EV) were coexpressed in HEK293 cells. After 24 h, the cells were stimulated with IFN-β for 6 h, lysed, and subjected to a luciferase assay. (C) Plasmids encoding the STAT1/2 binding promoter-Luc, pRL-TK, and plasmids expressing Lbpro (100 or 300 ng) or EV (300 ng) were cotransfected into PK15 cells. After 24 h posttransfection, the cells were collected and lysed for a luciferase assay after the cells were pretreated with IFN-β for 6 h. (D and E) Plasmids encoding Lbpro or EV were transfected into PK15 cells. After 24 h, the cells were treated with or without IFN-β for 6 h, and then infected with FMDV for 12 h. The virus plaque, virus titer, and cytopathic effect (CPE, scale bar, 250 μm) were determined. (F) Plasmids encoding Lbpro or EV were transfected into HEK293 cells. After 24 h, the cells were treated with or without IFN-β for 6 h, and then infected with VSV for 16 h. The virus GFP fluorescence intensity was observed and the VSV-GFP titer was determined (scale bar, 300 μm). (G) Lb was transfected into PK15 cells and the cells were treated as described in (D). The mRNA levels of the ISGs were measured by qPCR. Data are representative of three independent experiments. The data are shown as the mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

FIGURE 1.

FMDV Lbpro blocks IFN-β–induced signaling transduction and inhibits its activation. (A) Plasmids of the STAT1/2 binding promoter-Luc and pRL-TK were transfected into PK15 cells. After 24 h, the cells were infected with FMDV or left uninfected for 8 h. Next, the cells were either stimulated with IFN-β or left unstimulated for 6 h. Finally, the cells were collected and lysed for a luciferase assay. (B) Plasmids expressing the STAT1/2 binding promoter-Luc and pRL-TK with plasmids 3C, Lb, 3D, or an empty vector (EV) were coexpressed in HEK293 cells. After 24 h, the cells were stimulated with IFN-β for 6 h, lysed, and subjected to a luciferase assay. (C) Plasmids encoding the STAT1/2 binding promoter-Luc, pRL-TK, and plasmids expressing Lbpro (100 or 300 ng) or EV (300 ng) were cotransfected into PK15 cells. After 24 h posttransfection, the cells were collected and lysed for a luciferase assay after the cells were pretreated with IFN-β for 6 h. (D and E) Plasmids encoding Lbpro or EV were transfected into PK15 cells. After 24 h, the cells were treated with or without IFN-β for 6 h, and then infected with FMDV for 12 h. The virus plaque, virus titer, and cytopathic effect (CPE, scale bar, 250 μm) were determined. (F) Plasmids encoding Lbpro or EV were transfected into HEK293 cells. After 24 h, the cells were treated with or without IFN-β for 6 h, and then infected with VSV for 16 h. The virus GFP fluorescence intensity was observed and the VSV-GFP titer was determined (scale bar, 300 μm). (G) Lb was transfected into PK15 cells and the cells were treated as described in (D). The mRNA levels of the ISGs were measured by qPCR. Data are representative of three independent experiments. The data are shown as the mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Close modal

IFN-β combines with its receptors and induces the phosphorylation of STAT1 and STAT2. Phosphorylated STAT1 and STAT2 then interact with IRF9 to form a complex of ISGF3, which binds with the IFN-sensitive response element, finally inducing the antiviral ISG expression. Thus, we next investigated the role of Lbpro on STAT1/2 phosphorylation after IFN-β stimulation. The results demonstrated that after IFN-β treatment, Lbpro inhibited both STAT1 and STAT2 phosphorylation (Fig. 2A). Moreover, we found that Lbpro also reduced the level of STAT1/2 protein (Fig. 2A). Upon IFN-β stimulation, phosphorylated STAT1 and STAT2 translocate from the cytoplasm to the nucleus. We examined the cellular localization of Lbpro and STAT1 and STAT2 proteins after IFN-β stimulation with an immunofluorescence assay. The confocal images shown in (Fig. 2B suggest that Lbpro blocked IFN-β–induced STAT1/2 shuttling from the cytoplasm to the nucleus. This phenomenon was further corroborated by nuclear and cytoplasmic fractionation experiments. As shown in (Fig. 2C, greater levels of p-STAT1 and p-STAT2 were accumulated in both fractions in the EV-expressed compared with the Lbpro-expressed cells after IFN-β treatment. Moreover, the levels of STAT1 and STAT2 protein expression were decreased after Lbpro expression. Taken together, these data suggest that FMDV Lbpro inhibits STAT-dependent signal transduction and decreases STAT1/2 stability and translocation.

FIGURE 2.

FMDV Lbpro inhibits IFN-β–induced signal transduction by decreasing STAT1/2 protein stability. (A) A plasmid expressing Lbpro or EV was expressed in PK15 cells. After 24 h posttransfection, the cells were stimulated with IFN-β at the indicated time points, lysed, and detected with a Western blotting analysis using the corresponding Abs. (B) Plasmids encoding Lbpro or EV together with porcine myc-STAT1 or porcine myc-STAT2 were coexpressed in HEK293 cells. At 24 h posttransfection, the cells were treated with IFN-β or left untreated for 1 h; the location of protein with fluorescence was imaged by confocal microscopy. Scale bars, 50 μm. (C) A plasmid encoding Lbpro or EV was transfected into HEK293 cells for 24 h, followed by treatment with IFN-β or left untreated at the corresponding times. Cell proteins were extracted using a cellular fraction extraction kit, and Western blotting was performed to detect the cellular fraction. Data are representative of three independent experiments.

FIGURE 2.

FMDV Lbpro inhibits IFN-β–induced signal transduction by decreasing STAT1/2 protein stability. (A) A plasmid expressing Lbpro or EV was expressed in PK15 cells. After 24 h posttransfection, the cells were stimulated with IFN-β at the indicated time points, lysed, and detected with a Western blotting analysis using the corresponding Abs. (B) Plasmids encoding Lbpro or EV together with porcine myc-STAT1 or porcine myc-STAT2 were coexpressed in HEK293 cells. At 24 h posttransfection, the cells were treated with IFN-β or left untreated for 1 h; the location of protein with fluorescence was imaged by confocal microscopy. Scale bars, 50 μm. (C) A plasmid encoding Lbpro or EV was transfected into HEK293 cells for 24 h, followed by treatment with IFN-β or left untreated at the corresponding times. Cell proteins were extracted using a cellular fraction extraction kit, and Western blotting was performed to detect the cellular fraction. Data are representative of three independent experiments.

Close modal

To further determine whether FMDV Lbpro targeting to STAT1/2 was a contributing factor to the decreased STAT expression and translocation interference following IFN-β stimulation, Lbpro was coexpressed with myc-porSTAT1 (porcine STAT1) or myc-porSTAT2, followed by coimmunoprecipitation (co-IP) detection with tag Abs. (Fig. 3A and 3B show that Lbpro interacted with STAT1/2 directly, whereas no L-STAT complex was detected when IgG was used the IP Ab. Next, we examined the interaction of Lbpro and endogenous STAT1 or STAT2. As expected, Lbpro also associated with endogenous STAT1/2 (Fig. 3C). These data suggest that Lbpro may target the STAT1/2 proteins to interfere with IFN-β–induced signal transduction.

FIGURE 3.

FMDV Lbpro binds to STAT1 and STAT2 proteins. (A and B) Plasmids encoding Lbpro and myc-porSTAT1 (A) or STAT2 (myc-porSTAT2) (B) were cotransfected into HEK293 cells. After 24 h posttransfection, the cells were collected and lysed for co-IP and Western blotting with anti-myc or anti-Flag Abs to detect the protein–protein interactions. (C) Cell lysates from HEK293 cells transfected with plasmids encoding Lbpro for 24 h were analyzed for endogenous STAT1/2 by co-IP and Western blotting using corresponding Abs. Data are representative of three independent experiments.

FIGURE 3.

FMDV Lbpro binds to STAT1 and STAT2 proteins. (A and B) Plasmids encoding Lbpro and myc-porSTAT1 (A) or STAT2 (myc-porSTAT2) (B) were cotransfected into HEK293 cells. After 24 h posttransfection, the cells were collected and lysed for co-IP and Western blotting with anti-myc or anti-Flag Abs to detect the protein–protein interactions. (C) Cell lysates from HEK293 cells transfected with plasmids encoding Lbpro for 24 h were analyzed for endogenous STAT1/2 by co-IP and Western blotting using corresponding Abs. Data are representative of three independent experiments.

Close modal

As shown in (Fig. 2, the level of STAT1 and STAT2 proteins was decreased after Lbpro transfection. To further explore the mechanism behind this observation, we first characterized the effect of Lbpro on STAT1 and STAT2. As shown in (Fig. 4A and 4C, Lbpro overexpression reduced the level of myc-STAT1 (porSTAT1 or human STAT1) and STAT2-Flag (porSTAT2) proteins. In addition, we found that Lbpro decreased the level of STAT1 and STAT2 proteins in a dose-dependent manner (Fig. 4B, 4D). Interestingly, we observed a fragment of STAT2 following Lbpro expression (Fig. 4D).

FIGURE 4.

Lbpro cleaves STAT1 and STAT2 proteins through protease activity to block IFN-I–induced activation. (A and C) Plasmids expressing Lbpro, or EV together with myc-hSTAT1 (human), myc-porSTAT1 (porcine), and myc-STAT2 (porcine), were cotransfected into PK15 cells. After 24 h posttransfection, the cells were collected and lysed for Western blotting to analyze the level of protein expression using the indicated Abs. (B and D) Plasmids expressing an increasing amount of HA-L together with porcine myc-STAT1 or porcine myc-STAT2 were cotransfected into HEK293 cells. After 24 h posttransfection, the cells were collected and lysed for Western blot analysis. (E and F) Plasmids encoding Lbpro, LC51A mutant (cysteine mutated to alanine at residue 51), or EV and porcine Flag-STAT1 (E) or porcine STAT2-Flag (F) were cotransfected into HEK293 cells. After 24 h posttransfection, the cells were stimulated with IFN-β for the indicated time points. Cells were collected and lysed for Western blot analysis with the corresponding Abs. (G and H) PK15 cells were transfected with porcine Flag-STAT1 or porcine Flag-STAT2 and EV, Lbpro, or LC51A. After 24 h, the cells were treated with DMSO, cycloheximide (CHX, 50 μg/ml, translation inhibitor) for 24 h, or actinomycin D (0.5 μg/ml, transcription inhibitor) for 10 h, followed by the detection of the STAT1 and STAT2 proteins. (I) Purified LD163N/D164N or WT Lbpro was added together with purified STAT1, STAT2, or eIF-4G within 2 h followed by an assessment of the STAT1 and STAT2 proteins. (J) The plasmid expressing the STAT1/2 binding promoter-Luc and plasmids expressing empty vector (EV), LD163N/D164N, intact Lbpro, or LC51A were coexpressed in HEK293 cells. After 24 h posttransfection, the cells were treated with IFN-β or left untreated for 6 h. The cells were lysed and analyzed by a luciferase assay. (K and L) Plasmids expressing porcine STAT1 (K) or porcine STAT2 (L) together with Lbpro or EV were coexpressed in HEK293 cells. After 24 h posttransfection, the cells were stimulated with rupintrivir protease inhibitor or left unstimulated for 10 h. The cells were collected and lysed for Western blotting to analyze the level of proteins expression. The cells were stimulated, collected, and lysed for Western blotting. (MO) Plasmids encoding Lbpro, LC51A, or EV were transfected into PK15 cells. After 24 h, the cells were treated with IFN-β or left untreated for 6 h, and then after the FMDV was infected for 12 h, the virus was collected. PK15 cells were incubated with serial 10-fold dilutions of collected FMDV for 1 h at 37°C. After the infection periods, the virus titer, cytopathic effect (CPE, scale bar, 250 μm), and plaque of FMDV were determined. (P) Plasmids encoding Lbpro, LC51A, or EV were transfected into HEK293 cells. After 24 h, the cells were treated with IFN-β or left untreated for 6 h, and then infected with VSV-GFP for 16 h, and the virus was collected. The GFP fluorescence intensity and virus titer of VSV-GFP were observed and determined (scale bar, 300 μm). (Q) The plasmid expressing the STAT1/2 binding promoter-Luc and plasmids expressing a series of Lbpro mutants, intact Lbpro, or empty vector were coexpressed in HEK293 cells. After 24 h posttransfection, the cells were treated with IFN-β for 6 h, lysed, and analyzed by a luciferase assay. (R) Plasmids encoding Lbpro, LC51A, or EV were transfected into PK15 cells. After 24 h, the cells were infected with FMDV for 10 h, followed by treatment with IFN-β or left untreated for 6 h. The cells were collected and lysed, and the total lysates were subjected to qPCR to determine the level of mRNA expression of ISGs and FMDV. Data are representative of three independent experiments.

FIGURE 4.

Lbpro cleaves STAT1 and STAT2 proteins through protease activity to block IFN-I–induced activation. (A and C) Plasmids expressing Lbpro, or EV together with myc-hSTAT1 (human), myc-porSTAT1 (porcine), and myc-STAT2 (porcine), were cotransfected into PK15 cells. After 24 h posttransfection, the cells were collected and lysed for Western blotting to analyze the level of protein expression using the indicated Abs. (B and D) Plasmids expressing an increasing amount of HA-L together with porcine myc-STAT1 or porcine myc-STAT2 were cotransfected into HEK293 cells. After 24 h posttransfection, the cells were collected and lysed for Western blot analysis. (E and F) Plasmids encoding Lbpro, LC51A mutant (cysteine mutated to alanine at residue 51), or EV and porcine Flag-STAT1 (E) or porcine STAT2-Flag (F) were cotransfected into HEK293 cells. After 24 h posttransfection, the cells were stimulated with IFN-β for the indicated time points. Cells were collected and lysed for Western blot analysis with the corresponding Abs. (G and H) PK15 cells were transfected with porcine Flag-STAT1 or porcine Flag-STAT2 and EV, Lbpro, or LC51A. After 24 h, the cells were treated with DMSO, cycloheximide (CHX, 50 μg/ml, translation inhibitor) for 24 h, or actinomycin D (0.5 μg/ml, transcription inhibitor) for 10 h, followed by the detection of the STAT1 and STAT2 proteins. (I) Purified LD163N/D164N or WT Lbpro was added together with purified STAT1, STAT2, or eIF-4G within 2 h followed by an assessment of the STAT1 and STAT2 proteins. (J) The plasmid expressing the STAT1/2 binding promoter-Luc and plasmids expressing empty vector (EV), LD163N/D164N, intact Lbpro, or LC51A were coexpressed in HEK293 cells. After 24 h posttransfection, the cells were treated with IFN-β or left untreated for 6 h. The cells were lysed and analyzed by a luciferase assay. (K and L) Plasmids expressing porcine STAT1 (K) or porcine STAT2 (L) together with Lbpro or EV were coexpressed in HEK293 cells. After 24 h posttransfection, the cells were stimulated with rupintrivir protease inhibitor or left unstimulated for 10 h. The cells were collected and lysed for Western blotting to analyze the level of proteins expression. The cells were stimulated, collected, and lysed for Western blotting. (MO) Plasmids encoding Lbpro, LC51A, or EV were transfected into PK15 cells. After 24 h, the cells were treated with IFN-β or left untreated for 6 h, and then after the FMDV was infected for 12 h, the virus was collected. PK15 cells were incubated with serial 10-fold dilutions of collected FMDV for 1 h at 37°C. After the infection periods, the virus titer, cytopathic effect (CPE, scale bar, 250 μm), and plaque of FMDV were determined. (P) Plasmids encoding Lbpro, LC51A, or EV were transfected into HEK293 cells. After 24 h, the cells were treated with IFN-β or left untreated for 6 h, and then infected with VSV-GFP for 16 h, and the virus was collected. The GFP fluorescence intensity and virus titer of VSV-GFP were observed and determined (scale bar, 300 μm). (Q) The plasmid expressing the STAT1/2 binding promoter-Luc and plasmids expressing a series of Lbpro mutants, intact Lbpro, or empty vector were coexpressed in HEK293 cells. After 24 h posttransfection, the cells were treated with IFN-β for 6 h, lysed, and analyzed by a luciferase assay. (R) Plasmids encoding Lbpro, LC51A, or EV were transfected into PK15 cells. After 24 h, the cells were infected with FMDV for 10 h, followed by treatment with IFN-β or left untreated for 6 h. The cells were collected and lysed, and the total lysates were subjected to qPCR to determine the level of mRNA expression of ISGs and FMDV. Data are representative of three independent experiments.

Close modal

Lbpro is a well-characterized papain-like proteinase and its protease activity site is located at amino acid residue 51 (35). To elucidate the effect of papain-like activity on IFN-β–induced signaling, a mutant of LC51A was evaluated in IFN-β–stimulated HEK293 cells coexpressing the STAT1 and STAT2 proteins. The results showed that LC51A restored the STAT1/2 phosphorylation and protein levels in HEK293 cells stimulated with IFN-β (Fig. 4E, 4F). The grayscale analysis results also showed that Lbpro reduced the STAT1/2 proteins and their phosphorylation level compared with LC51A or EV (Supplemental Fig. 1).

Previous studies have demonstrated that L cleaves the translation initiation factor of eIF-4G to affect host cell translation (36, 37). To eliminate the effect of cleavage of eIF-4G by Lbpro on the reduction of STAT proteins, treatment with actinomycin D (transcription inhibitor) or cycloheximide (translation inhibitor) was added after Lbpro or LC51A expression. As shown in (Fig. 4G and 4H, we found that treatment with protein translation or transcription inhibitors did not restore the STAT1 and STAT2 protein levels during Lbpro expression, and Lbpro still decreased the level of STAT1 and STAT2 protein. This suggests that the reduction in the level of the STAT1 and STAT2 proteins was not dependent on eIF-4G during Lbpro expression.

Moreover, to determine whether the Lbpro-mediated reduction in STAT protein levels was dependent on eIF-4G cleavage, we constructed D163 and D164 (D163N/D164N) amino acids mutagenesis of Lpro, which can partially abolish the ability of eIF-4G cleavage (36, 37). A D163N/D164N mutant (LD163N/D164N) of Lpro, and WT Lpro, as well as STAT1 and STAT2 proteins, were purified, and LD163N/D164N or Lpro was incubated together with STAT1 or STAT2. As observed in (Fig. 4I, LD163N/D164N had the ability to cleave STAT1 and STAT2. This finding suggests that the decrease in STAT1 and STAT2 proteins may not depend on eIF-4G cleavage. We also assessed the effect of LD163N/D164N on IFN-β–induced STAT1/2 promoter activation following IFN-β stimulation. As shown in (Fig. 4J, it was found that although LD163N/D164N could partially lose the function of eIF-4G cleavage, it could still inhibit activation of the IFN-β–induced STAT1/2 promoter. These results suggest that eIF-4G cleavage is not the reason for the decrease in STAT1 and STAT2 proteins.

To further determine whether STAT1/2 cleavage was related to Lbpro papain-like protease activity, the papain protease inhibitor rupintrivir was also added to the medium during STAT1/2 expression. After Lbpro expression, the decrease in STAT1 and STAT2 protein was inhibited by rupintrivir treatment (Fig. 4K, 4L). The STAT2 cleavage fragment that belongs to the full-length protein disappeared after rupintrivir treatment compared with DMSO treatment (Fig. 4L). Furthermore, to confirm whether L protein overexpression induces caspase activation to cleave STAT proteins, we used different inhibitors, as shown in Supplemental Fig. 2. It was found that the caspase inhibitor Z-VAD-FMK could not alter the reduction in the level of STAT1/2 protein during Lbpro expression. These data suggest that Lbpro can cleave STAT1/2 using protease activity.

Next, we assessed the effects of Lbpro or LC51A on IFN-induced antiviral activity. As shown in (Fig. 4M–O, Lbpro- or LC51A-expressing PK15 cells were stimulated with IFN-β, followed by an infection with FMDV. The virus titer, CPE, and plaque of FMDV assay results indicated that LC51A failed to promote FMDV replication compared with Lbpro. Consistently, Lbpro- or LC51A-expressing HEK293 cells were stimulated with IFN-β, followed by an infection with VSV-GFP. GFP fluorescence intensity and virus titer of VSV-GFP results in (Fig. 4P showed that Lbpro increased the replication of VSV-GFP during IFN-β stimulation as compared with EV, and LC51A failed to promote VSV-GFP replication compared with Lbpro. The effects of a series of Lbpro mutants on STAT1/2 binding promoter activity were evaluated in IFN-β–stimulated HEK293 cells coexpressing the STAT1/2-luc reporter. As seen in (Fig. 4Q, LC51A, the mutants of Lb (△1–120 bp), and Lb (△1–315 bp) abolished the inhibition of Lbpro on STAT1/2 binding promoter reporter gene activation after IFN-β stimulation. In contrast, Lb (△316–630 bp) continued to exhibit a suppressive function to some extent. These data indirectly suggest that the N terminal of Lbpro, which contains the protease active site, is important for IFN-β–induced ISG production.

Following Lb or LC51A transfection, PK15 cells were subjected to IFN-β stimulation and FMDV infection as indicated in (Fig. 4R. The level of porcine ISG mRNA levels and FMDV titers were measured. Consistent with the above results, the mRNA expression of ISGs in the Lb-transfected PK15 cells was significantly lower than that in LC51A or EV-expressing cells following IFN-β treatment. In contrast, the FMDV titer was drastically increased in the cells transfected with Lb versus LC51A. Altogether, the results demonstrated that Lbpro could block the innate immune response by cleaving the level of STAT1 and STAT2 proteins. In addition, the LC51A mutant lost the ability to suppress IFN-β–induced signal transduction.

We also attempted to further evaluate the role of FMDV Lbpro on the STAT-protein stability at the virus level. To this end, PK15 cells were transfected with STAT1-Glag or STAT2-Flag, followed by the Lb knockout of FMDV (rFMDV LbKO) or the WT of FMDV (FMDV LbWT) infection at different times. The results shown in (Fig. 5A and 5B indicate that the STAT1 and STAT2 levels decreased upon rFMDV LbKO or FMDV LbWT infection. It was clear that STAT1/2 were substantially decreased at 12 hpi for either FMDV WT or FMDV LbKO, respectively; however, the STAT1/2 protein levels were significantly decreased after WT FMDV infection for 4 h, which is ahead of LbKO infection (Fig. 5A, 5B). Moreover, we observed that the decrease in endogenous STAT1/2 occurred earlier during FMDV LbWT than FMDV LbKO infection (Fig. 5C). Interestingly, the cleavage fragment of STAT2 disappeared following FMDV LbKO infection compared with FMDV LbWT infection.

FIGURE 5.

Lb deficiency decrease in the level of STAT1/2 proteins. (A and B) Porcine STAT1-Flag (A) or porcine STAT2-Flag (B) was transfected into PK15 cells. After 24 h, FMDV WT or L gene knockout (rFMDV LbKO) was permitted to infect the cells. At the indicated times, the cells were lysed and subjected to Western blotting. (C) FMDV WT or rFMDV LbKO infected PK15 cells at the corresponding time points, and cell lysates were subjected to Western blotting. qPCR was also performed to detect the FMDV titer. (D) PK15 cells were infected with FMDV WT or rFMDV LbKO at the indicated times. The levels of ISGs mRNA and the FMDV titer were detected with qPCR. (E) BHK21 cells were treated with IFN-β or left untreated for 6 h, the cells were infected with LbKO FMDV or FMDV LbWT, and the virus titer was assayed. (F and G) WT PK15 cells, MAVS−/−, IRF3−/−, STAT1−/−, or STAT2−/− knockout PK15 cells were treated with IFN-β or left untreated for 6 h. The cells were infected with LbKO FMDV or FMDV LbWT, and the virus titer was assayed. Data are representative of three independent experiments. The data are shown as the mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001.

FIGURE 5.

Lb deficiency decrease in the level of STAT1/2 proteins. (A and B) Porcine STAT1-Flag (A) or porcine STAT2-Flag (B) was transfected into PK15 cells. After 24 h, FMDV WT or L gene knockout (rFMDV LbKO) was permitted to infect the cells. At the indicated times, the cells were lysed and subjected to Western blotting. (C) FMDV WT or rFMDV LbKO infected PK15 cells at the corresponding time points, and cell lysates were subjected to Western blotting. qPCR was also performed to detect the FMDV titer. (D) PK15 cells were infected with FMDV WT or rFMDV LbKO at the indicated times. The levels of ISGs mRNA and the FMDV titer were detected with qPCR. (E) BHK21 cells were treated with IFN-β or left untreated for 6 h, the cells were infected with LbKO FMDV or FMDV LbWT, and the virus titer was assayed. (F and G) WT PK15 cells, MAVS−/−, IRF3−/−, STAT1−/−, or STAT2−/− knockout PK15 cells were treated with IFN-β or left untreated for 6 h. The cells were infected with LbKO FMDV or FMDV LbWT, and the virus titer was assayed. Data are representative of three independent experiments. The data are shown as the mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001.

Close modal

As shown in (Fig. 5D, the mRNA expression of ISGs, including OAS1, ISG15, ISG54, STAT1, and STAT2, increased significantly at 6 h after rFMDV LbKO infection compared with FMDV WT infection. Therefore, these data suggest that rFMDV LbKO infection delays the cleavage of STAT1/2 proteins and promotes IFN-β–induced signal transduction.

Moreover, we assessed the growth changes of rFMDV LbKO on cells lacking innate immune activity. First, BHK21 (IFN-β deficiency cells), MAVS-, IRF3-, STAT1-, and STAT2-knockout PK15 cells were infected with rFMDV LbKO or FMDV LbWT. As shown in (Fig. 5E, the titer of LbKO FMDV remained unchanged compared with that of WT FMDV in BHK21 cells; however, rFMDV LbKO growth was lower than that of FMDV LbWT after IFN-β stimulation. Furthermore, we found that in MAVS−/− or IRF3−/− cells, FMDV LbKO growth was similar compared with WT PK15 cells (Fig. 5F). In addition, rFMDV LbKO and FMDV LbWT replications also were assessed in STAT1−/− or STAT2−/− cells during IFN-β treatment or without treatment. (Fig. 5G shows that FMDV LbKO growth was lower compared with that of FMDV LbWT in STAT1 or STAT2 WT PK15 cells after IFN-β treatment. However, the titers were similar between FMDV LbKO and FMDV LbWT in STAT1−/− or STAT2−/− cells following IFN-β stimulation. These results indicate that Lb promotes FMDV replication related with innate immune activity after IFN-β treatment.

Because Lbpro reduced the level of STAT1/2 expression, we were curious about the Lbpro cleavage sites in STAT1/2. Although Lbpro targets several proteins for cleavage, only a small number of substrate sequences have been experimentally identified thus far. Moreover, the amino acid sequences of these proteins are not conserved motifs. To better understand the cleavage function of Lbpro, we first expressed Lbpro at increasing concentrations together with STAT1/2 and checked the molecular mass of the cleavage fragment protein. The results in (Fig. 6A show that Lbpro induced a marked reduction in the full-length STAT1 levels in a dose-dependent manner. Interestingly, a STAT1-derived small product >20 kDa was specifically detected with Abs for STAT1. To identify the cleavage site in STAT1, we examined the truncated STAT1 mutants, which divided the intact STAT1 protein into two or three segments on average (Fig. 6F). We did not pinpoint the exact cleavage site in STAT1; however, as seen in (Fig. 6B, the range was limited to aa 252–502.

FIGURE 6.

The cleavage region and site of STAT1 and STAT2 are identified during Lbpro expression. (A) EV or increasing amounts of plasmid encoding Flag-L (0, 1, 2, or 4 μg) and plasmids encoding human myc-STAT1 were cotransfected into HEK293 cells. The cells were lysed 24 h later, and the samples were analyzed by Western blot to assay the protein level. (B) EV or plasmid encoding HA-L and a series of indicated plasmids (deletion mutants of myc-STAT1) were cotransfected into HEK293 cells and the cells were lysed 24 h later. The lysates were subjected to Western blotting. (C) Flag-L and plasmids encoding human myc-STAT1 deletion mutants were cotransfected into HEK293 cells, and the cells were lysed 24 h later. The samples were analyzed by co-IP to assay the protein interactions. (D and E) HA-Lb and human His-STAT2 deletion mutants were cotransfected into HEK293 cells separately, and the cells were lysed 24 h later. Lysates were subjected to Western blotting. The cleavage fragment is indicated with an asterisk. (F) Linear diagram of STAT1/2 and mutations. CCD, coiled-coil domain; DBD, DNA-binding domain; IAD, IRF association domain; LD, linker domain; ND, N domain; SH2, Src homology domain; TAD, transactivation domain. (G) STAT2 mutant (10Mut) (QQHEIESRIL to EERQTQLCTS) or WT STAT2 and Lb were transfected into HEK293 cells. After 24 h, STAT2 protein expression was detected. Data are representative of three independent experiments.

FIGURE 6.

The cleavage region and site of STAT1 and STAT2 are identified during Lbpro expression. (A) EV or increasing amounts of plasmid encoding Flag-L (0, 1, 2, or 4 μg) and plasmids encoding human myc-STAT1 were cotransfected into HEK293 cells. The cells were lysed 24 h later, and the samples were analyzed by Western blot to assay the protein level. (B) EV or plasmid encoding HA-L and a series of indicated plasmids (deletion mutants of myc-STAT1) were cotransfected into HEK293 cells and the cells were lysed 24 h later. The lysates were subjected to Western blotting. (C) Flag-L and plasmids encoding human myc-STAT1 deletion mutants were cotransfected into HEK293 cells, and the cells were lysed 24 h later. The samples were analyzed by co-IP to assay the protein interactions. (D and E) HA-Lb and human His-STAT2 deletion mutants were cotransfected into HEK293 cells separately, and the cells were lysed 24 h later. Lysates were subjected to Western blotting. The cleavage fragment is indicated with an asterisk. (F) Linear diagram of STAT1/2 and mutations. CCD, coiled-coil domain; DBD, DNA-binding domain; IAD, IRF association domain; LD, linker domain; ND, N domain; SH2, Src homology domain; TAD, transactivation domain. (G) STAT2 mutant (10Mut) (QQHEIESRIL to EERQTQLCTS) or WT STAT2 and Lb were transfected into HEK293 cells. After 24 h, STAT2 protein expression was detected. Data are representative of three independent experiments.

Close modal

From (Fig. 4C and 4D above, a Flag tag fused in the C-terminal of STAT2 protein was used, and a fragment at ?80 kDa was detected with a Flag Ab for STAT2. This suggested that the site of STAT2 cleavage by Lb protease was located at the N-terminal of the STAT2 protein. To confirm this hypothesis, we first constructed four STAT2 deletion mutants, using co-IP detection, as shown in (Fig. 6C. We found that Lpro could interact with STAT2 (1–316 aa), for which aa 316–865 were deleted. The results also indicated that the Lbpro-induced cleavage site of STAT2 was located at the N-terminal.

The STAT2 full protein molecular mass is 98 kDa. Based on the size of the STAT2 cleavage fragment (?80 kDa), we first constructed mutants that contained deletions at every 50 aa at the N-terminal of the STAT2 protein (Fig. 6F). We found that when the STAT2 (△1–150 aa) mutant (N-terminal of STAT2 mutant was deleted to 150 aa) was coexpressed with Lbpro, no cleavage fragment was found. The result also showed that the molecular mass of the STAT2 (△1–150 aa) mutant was similar to that of the large cleavage fragment of the intact STAT2 protein cleaved by Lbpro. Therefore, we speculated that the site of STAT2 cleavage by Lbpro was in the 100–150 aa at the STAT2 N-terminal of (Fig. 6D).

Next, we constructed the mutants that contained a deletion every 10 aa within the 100–150 aa at the STAT2 N-terminal. As shown in (Fig. 6E, the STAT2 mutant with a deletion in residues 140–150 (QQHEIESRIL) abolished Lbpro cleavage. Furthermore, we also constructed an Lbpro-cleaved site mutation (EERQTQLCTS) of STAT2. The mutant together with Lbpro was transfected into HEK293T cells. (Fig. 6G shows that no cleaved fragment of STAT2 was observed during Lb and STAT2 mutant coexpression. This finding suggested that the QQHEIESRIL region of STAT2 was essential for the Lbpro-mediated cleavage.

Taken together, we speculated that the cleavage site of STAT1 was in the range of aa 252–502 after Lbpro transfection. Moreover, we also demonstrated that the STAT2 protein cleavage site was located at residues 140–150 (QQHEIESRIL) after Lbpro expression.

Given that FMDV Lbpro was associated with JAK-STAT signaling, to directly assess the effect of Lbpro on the IFN-induced signal transduction in vivo, we conducted a pig study to further corroborate the response of FMDV infection on the IFNs induced by signal transduction. Pigs were inoculated with rFMDV LbKO and FMDV WT to assess Lbpro-mediated cleavage of STAT1 and STAT2 in vivo. (Fig. 7A and 7B show that the level of STAT1 and STAT2 protein expression in the lymph nodes and spleen was decreased in the FMDV WT group compared with rFMDV LbKO before 5 dpi. Moreover, the mRNA level of ISGs, including OAS1, ISG15, ISG54, STAT1, and STAT2, from the spleen increased over time after rFMDV LbKO inoculation compared with FMDV WT (Fig. 7C). In addition, consistent with the above results, we observed a decrease in STAT1 and STAT2 proteins by immunofluorescence staining in FMDV LbWT–infected pigs compared with rFMDV LbKO (Fig. 7D). These results indicate that Lbpro inhibits JAK-STAT signal transduction through decreasing the stability of the STAT1 and STAT2 proteins.

FIGURE 7.

Lb cleaves STAT1/2 proteins in pigs. Fifteen pigs were inoculated with FMDV WT, rFMDV LbKO, or PBS, respectively. (A and B) After viral challenge, tissue lymph nodes and the spleen were lysed. The samples were prepared and analyzed for STAT1 and STAT2 expression. (C) The level of ISG mRNA expression was detected by qPCR from spleens collected at different time points. (D) Confocal microscopy images of tissues after inoculation with FMDV WT, LbKO, or PBS. Colocalization of STAT1 (green), STAT2 (red), DAPI (blue), and FMDV (pink) was assessed. Original magnification, ×5; insets, × 35. (E) The FMDV neutralizing antibody titer or comprehensive neutralizing effects in serum were detected by a mAb competition-based ELISA antiviral titer (left) and cell-based comprehensive neutralizing effect (right). Data are representative of three independent experiments. The data are shown as the mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

FIGURE 7.

Lb cleaves STAT1/2 proteins in pigs. Fifteen pigs were inoculated with FMDV WT, rFMDV LbKO, or PBS, respectively. (A and B) After viral challenge, tissue lymph nodes and the spleen were lysed. The samples were prepared and analyzed for STAT1 and STAT2 expression. (C) The level of ISG mRNA expression was detected by qPCR from spleens collected at different time points. (D) Confocal microscopy images of tissues after inoculation with FMDV WT, LbKO, or PBS. Colocalization of STAT1 (green), STAT2 (red), DAPI (blue), and FMDV (pink) was assessed. Original magnification, ×5; insets, × 35. (E) The FMDV neutralizing antibody titer or comprehensive neutralizing effects in serum were detected by a mAb competition-based ELISA antiviral titer (left) and cell-based comprehensive neutralizing effect (right). Data are representative of three independent experiments. The data are shown as the mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Close modal

A comprehensive neutralizing titer represents a key marker of the protective immune response against viral infection. Using the mAb competition-based ELISA method and cell-based comprehensive neutralizing effect detection, we determined the anti-FMDV WT-neutralizing effect in pig sera following inoculation with FMDV WT or rFMDV LbKO. The results of the mAb competition-based ELISA detection showed that all pigs inoculated with both FMDV Ags developed detectable FMDV Ab responses on a similar level after 5 dpi, whereas the Ab titers were lower in the rFMDV LbKO group immediately after inoculation (Fig. 7E). Interestingly, in cell-based comprehensive neutralizing effect detection, higher and different titers of the anti-FMDV WT-neutralizing effect were detectable in BHK21 cells on days 1, 3, and 5 postimmunization compared with FMDV WT. On day 10 postimmunization, a similar trend occurred (Fig. 7E).

Taken together, our results suggest that FMDV WT infection hindered the JAK-STAT signaling responses in pigs, supporting the function of Lbpro-dependent STAT cleavage, and suppressed the host defense upon FMDV infection.

ISGs are important components of innate immune antiviral response. Viruses have evolved different methods of evading the innate immune response by interfering with various steps involved in IFN-induced JAK-STAT signaling. To survive in the host, FMDV utilizes viral proteins to heavily suppress the cellular innate immune response to create a “friendly” environment for successful viral replication. With regard to IFN-induced JAK-STAT signaling, a previous study reported that the FMDV 3C protein induced KPNA1 degradation through proteasome- and caspase-independent methods to disrupt the nuclear localization signal receptor for tyrosine-phosphorylated STAT1, thereby blocking JAK-STAT signaling (18). However, in this study, we found that FMDV Lbpro represented another candidate through which IFN-induced JAK-STAT signaling can be inhibited. Lbpro is a well-known protein that plays a regulatory role in virus replication (38, 39), host protein synthesis suppression (40), and host defense disruption (28, 33, 34, 41, 42). Although the functions of Lbpro have been studied more recently, the effect of Lbpro on the JAK-STAT signaling pathway has not been reported.

STAT1 and STAT2 proteins are also the target for other viruses, including the bluetongue virus NS3 protein, which is ubiquitinated on lysine 13 and 15 and recruits an E3 ligase for STAT2 degradation (43), and the Zika virus NS2A targets STAT1 and STAT2 to promote their degradation (44).

In this study, to evaluate the role of the IFN-β–induced JAK-STAT pathway during FMDV infection, we studied the interplay between STAT1/2 and the viral Lbpro complex. Our model revealed that FMDV infection is accompanied by the production of Lbpro, which targets and cleaves STAT1/2 to antagonize IFN-β–induced signaling, and such cleavage occurred prior to STAT1/2 phosphorylation. We also demonstrated that the cleavage these proteins were dependent on protease catalytic activity. Previous studies have shown that the L protease cleaves eIF-4G to inhibit host cell translation. Our results also determined that Lbpro suppresses FMDV-induced ISGs of STAT1 and STAT2 mRNA expression. The caspase signaling, transcription, and translation inhibition results indicated that the effects of Lbpro on STAT protein stability are independent of caspase, eIF-4G, and mRNA transcription.

Evidence of STAT1 and STAT2 cleavage was also observed during infection with FMDV LbWT and rFMDV LbKO. We also found that rFMDV LbKO growth was lower compared with FMDV LbWT. Because both the genome of FMDV LbWT and rFMDV LbKO can be recognized by the RIG-I–like receptor and eventually induce IFN production, we speculate that the reduction of rFMDV LbKO replication may due to: 1) the Lb of FMDV LbWT inhibits the production of IFN, in which L protease cleaves TBK1 or MAVS to inhibit IFN production, resulting in a decrease in the expression of antiviral ISGs, and ultimately increased FMDV LbWT replication; and/or 2) the Lb of FMDV LbWT inhibits the IFN-induced JAK-STAT pathway activation, which in turn antagonizes the expression of antiviral ISGs and increases the replication of FMDV LbWT. Using the IFN-deficient cells (BHK21; MAVS−/−, IRF3−/−, STAT1−/−, and STAT2−/−), we demonstrated that rFMDV LbKO replication was reduced because Lb affects both the upstream signaling of IFN-β production and downstream IFN-induced JAK-STAT signaling.

The levels of STAT1 and STAT2 protein expression were noticeably decreased during Lb expression and FMDV WT infection in vitro and in vivo. When STAT1 or STAT2 was coexpressed with Lbpro, a small protein fragment of >20 kDa of STAT1 or a fragment of 80 kDa of STAT2 was detected. Lbpro-mediated cleavage in a protease-dependent manner was found in MDA5, TBK1, G3BP1, eIF-4G, LGP2, and Gemin5, thereby blocking their respective downstream signaling (25, 2931, 42, 45); however, only a very small number of substrate sequences were experimentally identified (25, 42, 45). Rodríguez Pulido et al. (42) analyzed the LGP2 sequence with Gemin5 and Daxx, and identified a conserved motif of (R)(R/K)(L/A)(R). However, we did not find any conserved motif for the STAT1 and STAT2 proteins when compared with LGP2, Germin5, and Daxx. In this study, we were unable to identify the exact cleavage site of STAT1 after Lbpro expression; however, we found that the cleavage site was located in the 252–502 aa range. For the cleavage site of STAT2 after Lbpro expression, as shown in (Fig. 4C and 4D, using STAT2 protein, which contains a Flag tag at the C terminus, we found a high-molecular-mass cleavage fragment of STAT2 (∼80 kDa) after Lbpro expression. This finding suggests that the STAT2 cleavage site is in the N terminus of the protein. When we detected the interaction between the STAT2 deletion mutants and Lbpro, the results showed that Lbpro interacts with 1–316 aa of STAT2. These results directly indicate that Lbpro targets the N terminus of STAT2. Finally, as shown in (Fig. 6D, there was no band within the 140- to 150-aa-deleted STAT2 and Lbpro coexpression. Therefore, we speculated that Lbpro recognizes the motif QQHEIESRIL, which spans 140–150 aa of STAT2. Moreover, we replaced the 140–150 aa of STAT2 with different characteristic amino acids and found that compared with WT STAT2, no cleavage fragment appeared in the mutant following Lb expression. Taken together, these results suggest that Lb cleaved both STAT1 and STAT2. According to the STAT1 and STAT2 domains, the cleavage position localized in the coiled-coil domain (CCD) and DNA binding domain of STAT1, and the CCD of STAT2. The CCD is also targeted by Zika virus, and the NS5 protein interacted with CCD of STAT2 to induce STAT2 degradation (46). Moreover, the CCD is essential for the IRF9 interaction. Thus, we speculated that the Lbpro cleavage function would likely abolish STAT1/2 and IRF9 complex formation.

The primary characteristic of Lbpro is a papain-like protease, and the cysteine at 51 aa is the catalytic residue (35). STAT1/2 cleavage was inhibited by the papain-like protease inhibitor, rupintrivir, and the LC51A mutant. This suggests that the protease activity of Lbpro is essential for STAT1/2 cleavage. The Lb deletion mutants that contain protease activity sites (△1–120 bp and △1–315 bp) lost the function to inhibit STAT1/2 binding promoter activity following IFN-β treatment. This finding also indirectly proved that the Lbpro protease activity could impact the IFN-I–induced antiviral effect.

Additionally, given that the STAT1 and STAT2 proteins are cleaved by Lbpro transfection, we also analyzed the fate of STAT1 and STAT2 during FMDV infection. The time for STAT1/2 cleavage was delayed with rFMDV LbKO compared with FMDV LbWT. Moreover, a moderate decline in the level of STAT1/2 was also observed at 9 h after rFMDV LbKO infection. The study by Du et al. (18) demonstrated that since FMDV 3C did not decrease the level of STAT1 and STAT2 expression of proteins, we excluded the effect of 3C on STAT1 and STAT2. Evidence of STAT1 and STAT2 protein cleavage was also observed during FMDV infection, and a decrease in STAT1 and STAT2 protein expression was observed from different tissues following FMDV infection. Thus, the STAT1 and STAT2 proteins were processed by Lbpro after FMDV infection. STAT1 and STAT2 protein cleavage was more serious in FMDV WT infected pig tissues, which compared with rFMDV LbKO infected tissues, suggesting that Lbpro plays an important role in the inhibition of JAK-STAT signaling. Somewhat confusingly, because the level of STAT1 and STAT2 protein expression was not cleaved significantly on 5 dpi, we speculate that these results may be due to the degradation of FMDV Lpro, which restored the level of STAT1 and STAT2 proteins. To confirm this suspicion, we also found that KPNA1 can induce Lpro degradation (data not shown).

In line with the FMDV copy numbers observed in the serum postinfection, the results from the anti-FMDV monoclonal competition-based ELISA testing showed that the Ab titers began increasing slowly at the earlier stage of infection. However, from BHK21 cell–based comprehensive neutralizing effect detection, the neutralizing effects were different between the inoculation with both viruses. We surmise that the FMDV might not effectively infect BHK21 cells due to the presence of antiviral cytokines, such as IFN or ISGs in the serum of rFMDV LbKO-infected cells.

Taken together, we propose a model depicting the mechanism through which Lbpro hijacks the IFN-induced activated JAK-STAT signaling pathway via decreasing the component stability of the pathway (Fig. 8). In this model, IFN-induced signaling transduction was hindered by the early viral proteins of Lbpro. Moreover, Lbpro targeted and cleaved STAT1/2 to inhibit IFN-induced signal transduction. The cleavage was dependent on eIF4G protein level. Therefore, this study expands the horizon for FMDV Lbpro to perform different functions.

FIGURE 8.

Model of Lbpro cleavage of STAT1/2 to inhibit IFN-induced signaling. FMDV Lbpro cleaved STAT1/2 with protease activity to inhibit IFN-I signal transduction.

FIGURE 8.

Model of Lbpro cleavage of STAT1/2 to inhibit IFN-induced signaling. FMDV Lbpro cleaved STAT1/2 with protease activity to inhibit IFN-I signal transduction.

Close modal

We thank Xuan Guo for modifying the manuscript.

This work was supported by the National Key Research and Development Program of China Grant 2021YFD1800300, Gansu Provincial Major Project for Science and Technology Development Grants 21ZD3NA001 and 19ZDNA001, and by Chinese Academy of Agricultural Science and Technology Innovation Project Grants CAAS-ZDRW202006, CAAS-ASTIP-2022-LVRI, and Y2021XK11. This work was also supported by the National Key Research and Development Program of China Grants 2018YFD0500103, 2017YFD0501100, and 2016YFD0500900, as well as by National Natural Sciences Foundation of China Grant 31602037.

X.S.M. and Z.K.L. arranged and performed experiments and conducted statistical analyses; X.S.M. wrote the manuscript; R.S. and X.F.N. performed quantitative RT-PCR measurements and the FMDV attack experiment; Z.B.Z. and S.M.C. contributed to pig experiments and collected pig serum; Y.R. performed purification of proteins; F.Y. completed FMDV recombination; Y.X.Z. and J.J.P. provided some experimental methods; W.J.C. performed FMDV-related experiments in the P3 laboratory; X.T.L. provided scientific guidance; and H.X.Z. provided funding for the studies and modified the manuscript.

The online version of this article contains supplemental material.

Abbreviations used in this article:

BHK21

baby hamster kidney 21

CCD

coiled-coil domain

co-IP

coimmunoprecipitation

CPE

cytopathic effect

dpi

days postinfection

EV

empty vector

FMDV

foot-and-mouth disease virus

HA

hemagglutinin

HEK293

human embryonic kidney 293

hpi

hours postinfection

IFN-I

type I IFN

IRF

IFN regulatory factor

ISG

IFN-stimulated gene

ISGF3

ISG factor 3

KPNA1

karyopherin α1

LbKO

Lb gene knockout

Lbpro

Lb leader protease

LC51A

Lbpro with cysteine substituted with alanine at amino acid residue 51

Lpro

leader protease

MOI

multiplicity of infection

PK15

porcine kidney 15

porSTAT

porcine STAT

qPCR

quantitative PCR

Tyk2

tyrosine kinase 2

VSV

vesicular stomatitis virus

VSV-GFP

VSV with a GFP tag

WT

wild-type

1.
Ishii
K. J.
,
S.
Koyama
,
A.
Nakagawa
,
C.
Coban
,
S.
Akira
.
2008
.
Host innate immune receptors and beyond: making sense of microbial infections.
Cell Host Microbe
3
:
352
363
.
2.
Ma
Z.
,
B.
Damania
.
2016
.
The cGAS-STING defense pathway and its counteraction by viruses.
Cell Host Microbe
19
:
150
158
.
3.
Melchjorsen
J.
2013
.
Learning from the messengers: innate sensing of viruses and cytokine regulation of immunity—clues for treatments and vaccines.
Viruses
5
:
470
527
.
4.
Said
E. A.
,
N.
Tremblay
,
M. S.
Al-Balushi
,
A. A.
Al-Jabri
,
D.
Lamarre
.
2018
.
Viruses seen by our cells: the role of viral RNA sensors.
J. Immunol. Res.
2018
:
9480497
.
5.
Wu
M. H.
,
P.
Zhang
,
X.
Huang
.
2010
.
Toll-like receptors in innate immunity and infectious diseases.
Front. Med. China
4
:
385
393
.
6.
Chow
K. T.
,
M.
Gale
Jr
.
2015
.
SnapShot: interferon signaling.
Cell
163
:
1808
1808.e1
.
7.
García-Sastre
A.
2017
.
Ten strategies of interferon evasion by viruses.
Cell Host Microbe
22
:
176
184
.
8.
Pestka
S.
,
C. D.
Krause
,
M. R.
Walter
.
2004
.
Interferons, interferon-like cytokines, and their receptors.
Immunol. Rev.
202
:
8
32
.
9.
Platanitis
E.
,
T.
Decker
.
2018
.
Regulatory networks involving STATs, IRFs, and NFκB in inflammation.
Front. Immunol.
9
:
2542
.
10.
Gongora
C.
,
N.
Mechti
.
1999
.
[Interferon signaling pathways].
Bull. Cancer
86
:
911
919
.
11.
Johnson
H. M.
,
E.
Noon-Song
,
C. M.
Ahmed
.
2019
.
Noncanonical IFN signaling, steroids, and STATs: a probable role of V-ATPase.
Mediators Inflamm.
2019
:
4143604
.
12.
Li
X.
,
S.
Leung
,
C.
Burns
,
G. R.
Stark
.
1998
.
Cooperative binding of Stat1-2 heterodimers and ISGF3 to tandem DNA elements.
Biochimie
80
:
703
710
.
13.
Der
S. D.
,
A.
Zhou
,
B. R.
Williams
,
R. H.
Silverman
.
1998
.
Identification of genes differentially regulated by interferon α, β, or γ using oligonucleotide arrays.
Proc. Natl. Acad. Sci. USA
95
:
15623
15628
.
14.
Li
K.
,
E.
Foy
,
J. C.
Ferreon
,
M.
Nakamura
,
A. C.
Ferreon
,
M.
Ikeda
,
S. C.
Ray
,
M.
Gale
Jr.
,
S. M.
Lemon
.
2005
.
Immune evasion by hepatitis C virus NS3/4A protease-mediated cleavage of the Toll-like receptor 3 adaptor protein TRIF.
Proc. Natl. Acad. Sci. USA
102
:
2992
2997
.
15.
Huang
L.
,
Q.
Liu
,
L.
Zhang
,
Q.
Zhang
,
L.
Hu
,
C.
Li
,
S.
Wang
,
J.
Li
,
Y.
Zhang
,
H.
Yu
, et al
.
2015
.
Encephalomyocarditis virus 3C protease relieves TRAF family member-associated NF-κB activator (TANK) inhibitory effect on TRAF6-mediated NF-κB signaling through cleavage of TANK.
J. Biol. Chem.
290
:
27618
27632
.
16.
Lei
X.
,
Z.
Sun
,
X.
Liu
,
Q.
Jin
,
B.
He
,
J.
Wang
.
2011
.
Cleavage of the adaptor protein TRIF by enterovirus 71 3C inhibits antiviral responses mediated by Toll-like receptor 3.
J. Virol.
85
:
8811
8818
.
17.
Wang
D.
,
L.
Fang
,
K.
Li
,
H.
Zhong
,
J.
Fan
,
C.
Ouyang
,
H.
Zhang
,
E.
Duan
,
R.
Luo
,
Z.
Zhang
, et al
.
2012
.
Foot-and-mouth disease virus 3C protease cleaves NEMO to impair innate immune signaling.
J. Virol.
86
:
9311
9322
.
18.
Du
Y.
,
J.
Bi
,
J.
Liu
,
X.
Liu
,
X.
Wu
,
P.
Jiang
,
D.
Yoo
,
Y.
Zhang
,
J.
Wu
,
R.
Wan
, et al
.
2014
.
3Cpro of foot-and-mouth disease virus antagonizes the interferon signaling pathway by blocking STAT1/STAT2 nuclear translocation.
J. Virol.
88
:
4908
4920
.
19.
Rai
D. K.
,
F.
Diaz-San Segundo
,
G.
Campagnola
,
A.
Keith
,
E. A.
Schafer
,
A.
Kloc
,
T.
de Los Santos
,
O.
Peersen
,
E.
Rieder
.
2017
.
Attenuation of foot-and-mouth disease virus by engineered viral polymerase fidelity.
J. Virol.
91
:
e00081-17
.
20.
Steinberger
J.
,
G.
Kontaxis
,
C.
Rancan
,
T.
Skern
.
2013
.
Comparison of self-processing of foot-and-mouth disease virus leader proteinase and porcine reproductive and respiratory syndrome virus leader proteinase nsp1α.
Virology
443
:
271
277
.
21.
Kristensen
T.
,
J.
Newman
,
S. H.
Guan
,
T. J.
Tuthill
,
G. J.
Belsham
.
2018
.
Cleavages at the three junctions within the foot-and-mouth disease virus capsid precursor (P1-2A) by the 3C protease are mutually independent.
Virology
522
:
260
270
.
22.
Yuan
H.
,
N.
Li
,
P.
Li
,
X.
Bai
,
P.
Sun
,
H.
Bao
,
X.
Gong
,
X.
Ma
,
Y.
Cao
,
K.
Li
, et al
.
2020
.
Modification of the second translation initiation site restricts the replication of foot-and-mouth disease virus in PK-15 cells.
Appl. Microbiol. Biotechnol.
104
:
8455
8466
.
23.
Kuehnel
E.
,
R.
Cencic
,
N.
Foeger
,
T.
Skern
.
2004
.
Foot-and-mouth disease virus leader proteinase: specificity at the P2 and P3 positions and comparison with other papain-like enzymes.
Biochemistry
43
:
11482
11490
.
24.
Dvorak
C. M.
,
D. J.
Hall
,
M.
Hill
,
M.
Riddle
,
A.
Pranter
,
J.
Dillman
,
M.
Deibel
,
A. C.
Palmenberg
.
2001
.
Leader protein of encephalomyocarditis virus binds zinc, is phosphorylated during viral infection, and affects the efficiency of genome translation.
Virology
290
:
261
271
.
25.
Guarné
A.
,
J.
Tormo
,
R.
Kirchweger
,
D.
Pfistermueller
,
I.
Fita
,
T.
Skern
.
1998
.
Structure of the foot-and-mouth disease virus leader protease: a papain-like fold adapted for self-processing and eIF4G recognition.
EMBO J.
17
:
7469
7479
.
26.
Gingras
A. C.
,
B.
Raught
,
N.
Sonenberg
.
1999
.
eIF4 initiation factors: effectors of mRNA recruitment to ribosomes and regulators of translation.
Annu. Rev. Biochem.
68
:
913
963
.
27.
Gradi
A.
,
N.
Foeger
,
R.
Strong
,
Y. V.
Svitkin
,
N.
Sonenberg
,
T.
Skern
,
G. J.
Belsham
.
2004
.
Cleavage of eukaryotic translation initiation factor 4GII within foot-and-mouth disease virus-infected cells: identification of the L-protease cleavage site in vitro.
J. Virol.
78
:
3271
3278
.
28.
de Los Santos
T.
,
F.
Diaz-San Segundo
,
M. J.
Grubman
.
2007
.
Degradation of nuclear factor kappa B during foot-and-mouth disease virus infection.
J. Virol.
81
:
12803
12815
.
29.
Pulido
M. R.
,
E.
Martínez-Salas
,
F.
Sobrino
,
M.
Sáiz
.
2020
.
MDA5 cleavage by the Leader protease of foot-and-mouth disease virus reveals its pleiotropic effect against the host antiviral response.
Cell Death Dis.
11
:
718
.
30.
Visser
L. J.
,
C.
Aloise
,
K. N.
Swatek
,
G. N.
Medina
,
K. M.
Olek
,
H. H.
Rabouw
,
R. J.
de Groot
,
M. A.
Langereis
,
T.
de Los Santos
,
D.
Komander
, et al
.
2020
.
Dissecting distinct proteolytic activities of FMDV Lpro implicates cleavage and degradation of RLR signaling proteins, not its deISGylase/DUB activity, in type I interferon suppression.
PLoS Pathog.
16
:
e1008702
.
31.
Visser
L. J.
,
G. N.
Medina
,
H. H.
Rabouw
,
R. J.
de Groot
,
M. A.
Langereis
,
T.
de Los Santos
,
F. J. M.
van Kuppeveld
.
2019
.
Foot-and-mouth disease virus leader protease cleaves G3BP1 and G3BP2 and inhibits stress granule formation.
J. Virol.
93
:
e00922-18
.
32.
Medina
G. N.
,
G. M.
Knudsen
,
A. L.
Greninger
,
A.
Kloc
,
F.
Díaz-San Segundo
,
E.
Rieder
,
M. J.
Grubman
,
J. L.
DeRisi
,
T.
de Los Santos
.
2017
.
Interaction between FMDV Lpro and transcription factor ADNP is required for optimal viral replication.
Virology
505
:
12
22
.
33.
Wang
D.
,
L.
Fang
,
P.
Li
,
L.
Sun
,
J.
Fan
,
Q.
Zhang
,
R.
Luo
,
X.
Liu
,
K.
Li
,
H.
Chen
, et al
.
2011
.
The leader proteinase of foot-and-mouth disease virus negatively regulates the type I interferon pathway by acting as a viral deubiquitinase.
J. Virol.
85
:
3758
3766
.
34.
Wang
D.
,
L.
Fang
,
R.
Luo
,
R.
Ye
,
Y.
Fang
,
L.
Xie
,
H.
Chen
,
S.
Xiao
.
2010
.
Foot-and-mouth disease virus leader proteinase inhibits dsRNA-induced type I interferon transcription by decreasing interferon regulatory factor 3/7 in protein levels.
Biochem. Biophys. Res. Commun.
399
:
72
78
.
35.
Gorbalenya
A. E.
,
E. V.
Koonin
,
M. M.
Lai
.
1991
.
Putative papain-related thiol proteases of positive-strand RNA viruses. Identification of rubi- and aphthovirus proteases and delineation of a novel conserved domain associated with proteases of rubi-, α- and coronaviruses.
FEBS Lett.
288
:
201
205
.
36.
Foeger
N.
,
W.
Glaser
,
T.
Skern
.
2002
.
Recognition of eukaryotic initiation factor 4G isoforms by picornaviral proteinases.
J. Biol. Chem.
277
:
44300
44309
.
37.
Schlick
P.
,
J.
Kronovetr
,
B.
Hampoelz
,
T.
Skern
.
2002
.
Modulation of the electrostatic charge at the active site of foot-and-mouth-disease-virus leader proteinase, an unusual papain-like enzyme.
Biochem. J.
363
:
493
501
.
38.
Belsham
G. J.
2013
.
Influence of the Leader protein coding region of foot-and-mouth disease virus on virus replication.
J. Gen. Virol.
94
:
1486
1495
.
39.
Steinberger
J.
,
T.
Skern
.
2014
.
The leader proteinase of foot-and-mouth disease virus: structure-function relationships in a proteolytic virulence factor.
Biol. Chem.
395
:
1179
1185
.
40.
Devaney
M. A.
,
V. N.
Vakharia
,
R. E.
Lloyd
,
E.
Ehrenfeld
,
M. J.
Grubman
.
1988
.
Leader protein of foot-and-mouth disease virus is required for cleavage of the p220 component of the cap-binding protein complex.
J. Virol.
62
:
4407
4409
.
41.
Swatek
K. N.
,
M.
Aumayr
,
J. N.
Pruneda
,
L. J.
Visser
,
S.
Berryman
,
A. F.
Kueck
,
P. P.
Geurink
,
H.
Ovaa
,
F. J. M.
van Kuppeveld
,
T. J.
Tuthill
, et al
.
2018
.
Irreversible inactivation of ISG15 by a viral leader protease enables alternative infection detection strategies.
Proc. Natl. Acad. Sci. USA
115
:
2371
2376
.
42.
Rodríguez Pulido
M.
,
M. T.
Sánchez-Aparicio
,
E.
Martínez-Salas
,
A.
García-Sastre
,
F.
Sobrino
,
M.
Sáiz
.
2018
.
Innate immune sensor LGP2 is cleaved by the Leader protease of foot-and-mouth disease virus.
PLoS Pathog.
14
:
e1007135
.
43.
Avia
M.
,
J. M.
Rojas
,
L.
Miorin
,
E.
Pascual
,
P. A.
Van Rijn
,
V.
Martín
,
A.
García-Sastre
,
N.
Sevilla
.
2019
.
Virus-induced autophagic degradation of STAT2 as a mechanism for interferon signaling blockade.
EMBO Rep.
20
:
e48766
.
44.
Fanunza
E.
,
F.
Carletti
,
M.
Quartu
,
N.
Grandi
,
L.
Ermellino
,
J.
Milia
,
A.
Corona
,
M. R.
Capobianchi
,
G.
Ippolito
,
E.
Tramontano
.
2021
.
Zika virus NS2A inhibits interferon signaling by degradation of STAT1 and STAT2.
Virulence
12
:
1580
1596
.
45.
Piñeiro
D.
,
J.
Ramajo
,
S. S.
Bradrick
,
E.
Martínez-Salas
.
2012
.
Gemin5 proteolysis reveals a novel motif to identify L protease targets.
Nucleic Acids Res.
40
:
4942
4953
.
46.
Parisien
J. P.
,
J. J.
Lenoir
,
G.
Alvarado
,
C. M.
Horvath
.
2022
.
The human STAT2 coiled-coil domain contains a degron for Zika virus interferon evasion.
J. Virol.
96
:
e0130121
.

The authors have no financial conflicts of interest.

This article is distributed under The American Association of Immunologists, Inc.,Reuse Terms and Conditions for Author Choice articles.

Supplementary data