Skip to Main Content
Table I.

Oligonucleotide primers used in this studya

Primer Sequence (5′→3′)DirectionPCR Product Size (bp)MutantProtein (aa)
Primers for pCMV2-flag vector (N-terminally flag-tagged protein expression)     
1 CGGAATTCCGGCAGAGCGAACATGGCCCCG → 1133 Wild type 377 
2 CGGAATTCGTTGGCCTGGAGGCTAGGT → 1085 N-Δ16 361 
3 CGGAATTCGGTGGCTGCCGCTCGTAAG → 992 N-Δ47 330 
4 CGGAATTCGCTGTACCACACTGCGCGG → 924 N-Δ70 307 
5 CGGAATTCGCAGTACAAGACGTGTCCC → 822 N-Δ103 274 
6 CGGAATTCGTCGTACAGAAAGGTGCCC → 704 N-Δ143 244 
7 CGGAATTCGCCCCTGGAAGAGATCATC → 596 N-Δ179 198 
8 CGGAATTCGCTAAACGAGAAGGAGGCC → 500 N-Δ211 166 
9 CGGAATTCGAATGTGTACCGCACACCC → 392 N-Δ247 130 
10 CGGAATTCGAAGTACATGGGTGCAGCG → 302 N-Δ277 100 
11 CGGAATTCGTGCTAAACGAGAAGGAG → 503 N-Δ226 150 
12 GCGGATCCTGAGAGCCAGTATTTATTG ← 630 CΔ150 211 
13 CGCGGATCCCTAGACATTCAGTGCGCTG ←    
Primer Sequence (5′→3′)DirectionPCR Product Size (bp)MutantProtein (aa)
Primers for pCMV2-flag vector (N-terminally flag-tagged protein expression)     
1 CGGAATTCCGGCAGAGCGAACATGGCCCCG → 1133 Wild type 377 
2 CGGAATTCGTTGGCCTGGAGGCTAGGT → 1085 N-Δ16 361 
3 CGGAATTCGGTGGCTGCCGCTCGTAAG → 992 N-Δ47 330 
4 CGGAATTCGCTGTACCACACTGCGCGG → 924 N-Δ70 307 
5 CGGAATTCGCAGTACAAGACGTGTCCC → 822 N-Δ103 274 
6 CGGAATTCGTCGTACAGAAAGGTGCCC → 704 N-Δ143 244 
7 CGGAATTCGCCCCTGGAAGAGATCATC → 596 N-Δ179 198 
8 CGGAATTCGCTAAACGAGAAGGAGGCC → 500 N-Δ211 166 
9 CGGAATTCGAATGTGTACCGCACACCC → 392 N-Δ247 130 
10 CGGAATTCGAAGTACATGGGTGCAGCG → 302 N-Δ277 100 
11 CGGAATTCGTGCTAAACGAGAAGGAG → 503 N-Δ226 150 
12 GCGGATCCTGAGAGCCAGTATTTATTG ← 630 CΔ150 211 
13 CGCGGATCCCTAGACATTCAGTGCGCTG ←    
a

Primers 1–11 were used as forward primers in combination with primer no. 13 as the reverse primer to generate the indicated mutants. Primers 1 and 12 were used for generating CΔ150. The upstream and downstream primers have EcoRI and BamHI sites, respectively, for facilitating an in-frame cloning of the products into the EcoRI and BamHI sites of pCMV2-falg vector. In the primer sequences, italicized letters represent restriction sites for EcoRI and BamHI; bold letters represent gene-specific sequences.

Close Modal

or Create an Account

Close Modal
Close Modal